What is coal composed of?

Answers

Answer 1

Answer:

Coal is a sedimentary deposit composed predominantly of carbon that is readily combustible. Coal is black or brownish-black, and has a composition that (including inherent moisture) consists of more than 50 percent by weight and more than 70 percent by volume of carbonaceous material.

Explanation:


Related Questions

which animal is the closest living relative to a t-rex?

Answers

Question:-

which animal is the closest living relative to a t-rex?

Answer:-

Chickens

Explanation:-

A small mass of T-Rex DNA was discovered, which closely resembles the DNA of modern chickens, further supporting the fact that chickens evolved from dinosaurs.

En la naturaleza existen más de 4000 minerales diferentes conocidos conocidos

Answers

La declaración 'en la naturaleza existen más de 4000 minerales diferentes conocidos' es VERDADERA. Estos elementos pueden ser diferenciados por sus propiedades.

Un mineral es un material inorgánico que se encuentra en la naturaleza, el cual posee una estructura atómica específica, como así también una composición particular.

El estudio de la propiedades físicas y químicas permiten diferenciar los diferetes tipos de minerales que se encuentran en la naturaleza.

Los minerales pueden encontrarse en su estado puro (por ejemplo, oro, plata, cobre) o bien estar combinados con otros materiales para formar diferentes elementos.

Por ejemplo, el cuarzo está formado por la unión del silicio con oxígeno.

Aprende más sobre minerales en:

https://brainly.com/question/25206900

What causes
the wind
and ocean
currents?

Answers

Liked my hardwork and make it brainliest

Explanation:

Ocean currents can be caused by wind,density differences in water masses caused by temperature and salinity variations,gravity,and events such as earthquakes and storms...Surface currents in the ocean are driven by global wind systems that are fueled by energy from the sun.

how do an enzyme and substrate to one another? what is the lock and key model of enzyme function?

Answers

The lock and key model is where the substrate has a specific shape which can fit into the specific shape of the active site of the enzyme, just like how a key has a specific shape which can fit into a specific lock.

In other words, the substrate is complementary (same shape) to a specific enzyme, so the substrate can bind/fit to the enzyme.

Help please help, anybody please

Answers

You need to show a picture I can’t help you if you don’t show it

thylacosmilus is a marsupial and smilodon is a mammal

Answers

Answer:

whats the question?

Discuss the concept of inserting a gene from marine algae into food crops. If researchers are successful in this endeavor, salt water is then an option for food crop irrigation. Discuss possible pros and cons of this idea. This response should be a minimum of 3 paragraphs to discuss all parts of the discussion question. Each paragraph should be a minimum of 5-7 well developed sentences.

Answers

The concept is creating a genetically modified organism, or GMO. This specifically would be done to try to water plants salt water and they could still grow. This is a pro in an area with little to no freshwater available, such as extreme drought. The cons of this is it would kill any other non salt water tolerant plant. Salt building up in the soil would make it so no other plant could grow there in the future, unless it was also made into a gmo. Overall this is not a feasible solution for most areas and most crops.

Which number label represents cellular respiration occurs and ATP is produced? 1 2 3 6

Answers

Structure 3 in the diagram represents where cellular respiration occurs and

ATP is produced.

The structure is known as the mitochondrion and it has an oval shape in

which series of reactions takes place to produce energy needed by the cells

of organisms.

The mitochondrion is regarded as the power house of the cell because

cellular respiration takes place which produces ATP. The ATP formed is the

usable form of energy by cells to preform their daily activities and for  

optimal functioning.

Read more about cellular respiration on https://brainly.com/question/12827458

Answer:

No 3 The mitocondrion

Explanation:

how long can prime rib stay in fridge before cooking

Answers

While it's best the next day, leftover prime rib is good for between five and seven days in the fridge or up to six months in the freezer.

HELP FOR MIDTERM STUDY GUIDE

During photosynthesis, what best describes the role of the compound with the chemical formula C6H12O6?
a. product that is not useful because of its low-energy chemical bonds
b. a product that is useful because of its high-energy chemical bonds
c. a reactant that is useful because of its high-energy chemical bonds
d. either a product or a reactant, depending on whether the cell needs to store energy or
release energy

Answers

It is b because of all the cells that produce the chemical bond

What supplies energy used to synthesize carbohydrates during the Calvin cycle?

Answers

The energy from light dependent reactions.

Explain how ADH is involved in the regulation of water in the body ​

Answers

Answer:

Antidiuretic hormone binds to receptors on cells in the collecting ducts of the kidney promotes reabsorption of water back into circulation, These channels transport solute-free water through tubular cells and back into blood, leading to a decrease in plasma osmolarity and an increase osmolarity of urine.

if a man with type ab blood marries a woman with type o blood, what blood types would you expect in their children

Answers

Answer: the child could be  A or B  blood type

24. What energy transformation occurs
during the combustion of coal in a
power plant?
A Electromagnetic energy is
transformed to thermal energy.
B Nuclear energy is transformed to
electromagnetic energy.
C Chemical energy is transformed to
thermal energy
D Chemical energy is transformed to
noclear energy

Answers

Answer:

c

Explanation:

it's not really a chemical per se but c is close enuff

why is the cell membrane so important to a cell

A: the membrane is responsible for producing proteins
B: the membrane regulates the movement of molecules in and out of the cell
C: the membrane coordinates all of the cell’s activities

Answers

Answer:

B

Explanation:

The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell. ... And those proteins which stick outside of the plasma membrane will allow for one cell to interact with another cell. The cell membrane also provides some structural support for a cell.

Answer:

B

Explanation:

The cell membrane provide protection for the cell.

retroviruses - Examples of RNA viruses are Cvid-19 or the virus that causes __

Answers

Answer:

I think death but im not sure

Explanation:

------

Help Me Please!!! ASAP
Name the organelle that is found in plant cells where photosynthesis takes place.

Identify where the light dependent and light independent reactions occur in this organelle. (Make sure to label which one is each)
Answer using at least 2 complete sentences.​

Answers

Answer:

Chloroplasts.

Light-dependent reactions occur in the thylakoid membranes. The light-independent reactions occur in the stroma of the chloroplasts.

Hope that helps

This model of the cell cycle includes two arrows that each represent a process in the cycle.


What do the two arrows represent?

Answers

Answer:

the order in which it is preformed.. sorry if in wrong

If you placed the celery into a bottle of colored water that was 35% sugar, would the colored water be seen in the celery? Why or why not?

Answers

Answer:

yes,The small "vessels" in the celery stalks carry the water and color to the leaves, like the way blood travels through your body.

Explanation:

rita has two small containers one holding liquid and one holding a gas rita transfers the substances to two larger containers compare the behaviors in the atoms in the liquid and in the gas once they are moved to larger containers

Answers

Answer:The behavior of the both liquid and gas will be different in some aspect and same in the other, lets see how:

Explanation:

As we have studies that liquids donot have a specific shape but do have a specific volume. So when the liquid will be transferred from small to large container, it will adapt the shape of new container but its volume will stay same as it was in old container.

On the other hand, about gases, we know that they donot have specific shapes and the volume is also not definite and depends on the shape of container. Therefore, the gas atoms will freely move in the container and the volume will be changes in large container.

A thick, brownish haze that forms when gases in the air react with sunlight

Answers

I think the answer is photochemical smog.

Hope this helped!

What happens during photosynthesis?
a. Autotrophs consume sugars
b. Autotrophs produce sugars
c. Heterotrophs produce ATP.
d. Heterotrophs consume ATP.

Answers

Answer:

Answer is option a. Autotrophs consume sugars

Explanation:

If you like my answer than please mark me brainliest thanks

The answer is: B - Autotrophs produce sugars.

5. In a tundra ecosystem, the carrying capacity for arctic hares is about 400 individuals. Which of these events is MOST likely to reduce the carrying capacity for arctic hares in the ecosystem by at least 25 percent?

(A) a severe storm that kills about 100 adult and young arctic hares

(B) a 25 percent decrease in the populations of foxes, wolves, or other predators of arctic hares

(C) the arrival in the ecosystem of a species that competes with the arctic hare for its food

(D) a temporary increase in the arctic hare population to more than 425 individuals

(E) a mutation that introduces a new fur color to the arctic hare population

Answers

A temporary increase in the arctic hare population to more than 425

individuals.

Hares are among the primary consumers as they are herbivores while foxes

are  secondary consumers which feeds on the hares.Foxes will hunt the

hares for food which will drastically reduce their population

Increasing their population by 425 individuals with the hares having a

population of 400 will surely decrease their carrying capacity in the tundra

ecosystem.

Read more about Ecosystem on https://brainly.com/question/842527

trait approaches to leadership propose that leadership ability arises from:

Answers

Trait approaches to leadership propose that leadership ability arises from distinctive personal characteristics. These personality traits shape personality.

Personality refers to the singular and unique patterns of thoughts, emotions and behaviors that exhibit a person.

The trait approaches represent different methodologies to analyze the personality of a person (for example, his/her leadership skills).

These approaches (trait approaches) put major emphasis on the traits of a person that can be considered markers of personality.

Learn more about personality traits here:

https://brainly.com/question/6491553

which organ system removes carbon dioxide from the bloodstream?

Answers

Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood.

The process by which an organism’s internal environment is kept stable in spite of changes in the external environment is called?

Answers

homeostasis:is the state of steady internal, physical, and chemical conditions maintained by living systems.

Which correctly matches the strand of DNA with his complementary strand of RNA

Answers

Answer:

I think it's C. hope that helps

The first step in sensation for some sensory systems is the __________, which modify incoming stimuli. Sensory receptors accessory structures absolute thresholds thermoreceptors.

Answers

During sensation, the first step for some sensory systems is the accessory structures, which are saddled with the responsibility of modifying an incoming stimuli.

A sensory system refers to components of the central nervous system (CNS) which comprises of the brain, neural tissues (pathways) and sensory neurons that are responsible for sensory functions, perception and processing of sensory information such as light, sound, heat, etc.

Basically, the five (5) main sense organs in the sensory system include the following:

SkinTongueEarsNoseEyes

The accessory structures is typically the first step the first step for some sensory systems because they are saddled with the responsibility of modifying an incoming stimuli.

Read more on accessory structures here: https://brainly.com/question/21151620

Answer:

Accessory Structures.

Explanation:

Can someone plz help Me? :(

Answers

C is the right answer

Answer:

C

Explanation:

I think it's c, but I might be wrong

[tex]\huge\boxed{Question:}[/tex]
I am just a teen who needs some help with homework. :)
This is my question:
What is the rarest eye colour in the world? Please help, it's due today.

Answers

Answer:

Green eyes

Explanation:

The production of melanin in the iris is what influences eye color. More melanin produces a darker coloring, while less makes for lighter eyes. Green eyes are the rarest, but there exist anecdotal reports that gray eyes are even rarer.

The rarest eye color in the world is green, only 2% of the population in the world have green eyes. To find out more about the list.....

1. Green eyes

Only 2% of people in the world are believed to have this eye color. It is most easily found in northern and Southern Europe and Western Asia.

2. Amber eyes

They are reddish-brown, with a golden and coppery undertone. Among the clear and beautiful eyes in the world, and according to the survey, the most iris, all eyes and beautiful in the world are according to the study, all eyes are rare and specific.

3. Red or violet eye

It is generated by the body thanks to some genetic changes. The most common is albinism, a disease that lowers melanin levels. Because of this, the hair and eyes can be distinguished.

With this information, we can conclude that there are several eye colors, but the most rare is the color green.

Learn more about Eye color in https://brainly.com/question/16133883

Other Questions
2.5kg of potatoes cost 1.40work out the cost of 4.25kg pls help (written response pls) 3) Match the outline for the Federalist Papers written in Federalist No. 1. (in order as they appear) the additional security which its adoption will afford to the preservation of that species of government, to liberty, and to property the insufficiency of the present confederation to preserve that Union its analogy to your own state constitution the necessity of a government at least equally energetic with the one proposed, to the attainment of this object the utility of the Union to your political prosperity the conformity of the proposed Constitution to the true principles of republican government Julia went into a movie theater and bought 2 bags of popcorn and 5 pretzels, costing a total of $37.25. Zoe went into the same movie theater and bough 8 bags of popcorn and 9 pretzels, costing a total of $102.25. Write and solve a system of equations to determine the price of each bag of popcorn and the price of each pretzel. HELP URGENT!!! RESPOND QUICKLY!!! Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?. Which graph could potentially have a correlation coeffiecient (r value) of 0.95? According to his running log, Baldwin averaged 4 miles per week last month and 25% more this month. How much did he average this month? can hellp me with this plzzzzzzz no links plz how are continental climates different from temperate climates Which word from Juliet's conversation with her mother is understood oneway by Lady Capulet and another way by the audience?A. CousinB. HeartC. TemperD. Love When corn is to be planted by the Indians, it is the work of the women folk to see to the sorting and cleaning of the best seed. It is also the women's work to see to the planting. (This was in olden times.)After the best seed has been selected, the planter measures the corn, lays down a layer of hay, then a layer of corn. Over this corn they sprinkle warm water and cover it with another layer of hay, then bind hay about the bundle and hang it up in a spot where the warm rays of the sun can strike it. While the corn is hanging in the sun, the ground is being prepared to receive it. Having finished the task of preparing the ground, the woman takes down her seed corn, which has by this time sprouted. Then she proceeds to plant the corn. Before she plants the first hill, she extends her heavenwards and asks the Great Spirit to bless her work, that she may have a good yield. After her prayer she takes four kernels and plants one at the north, one at the south, one at the east and one at the west sides of the first hill. This is asking the Great Spirit to give summer rain and sunshine to bring forth a good crop. For different growths of the corn, the women have an interpretation as to the character of the one who planted it.1st. Where the corn grows in straight rows and the cob is full of kernels to the end, this signifies that the planter of this corn is of an exemplary character, and is very truthful and thoughtful.2nd. If the rows on the ears of corn are irregular and broken, the planter is considered careless and unthoughtful. Also disorderly and slovenly about her house and person.3rd. When an ear of corn bears a few scattering kernels with spaces producing no corn, it is said that is a good sign that the planter will live to a ripe old age. So old will they be that like the corn, their teeth will be few and far between.4th. When a stalk bears a great many nubbins, or small ears growing around the large one, it is a sign that the planter is from a large and respectable family.After the corn is gathered, it is boiled into sweet corn and made into hominy; parched and mixed with buffalo tallow and rolled into round balls, and used at feasts, or carried by the warriors on the warpath as food. When there has been a good crop of corn, an ear is always tied at the top of the medicine pole, of the sun dance, in thanks to the Great Spirit for his goodness to them in sending a bountiful crop.Required:In one to two sentences, explain what the reaction of the Sioux to a good crop shows about the Sioux people. 1) 0.52 + 1.6 + 8.26 =2) 1.4 + 5.98 + 9 + 0.39 =3) 4.45 + 7 + 0.049 =4) 12.54 1. 054 =5) 0. 685 0. 5903 =6) (34. 89) (0.875) =7) (840) (0.625) =8) 28.5 0.87 =9) 104 6.4 =