what does arrows mean in science

Answers

Answer 1
It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant

Related Questions

Atoms are the most basic unit of matter. Two or more atoms from the same or different elements can combine to form molecules.
Cells are the most basic unit of life. Cells are made up of many different types of molecules. Which of the following accurately shows higher levels of organization within organisms, from least complex to most complex?
A. cells → organs → organ systems → tissues → organism
B. cells → tissues → organs → organ systems → organism
C. cells → organ systems → organs → tissues → organism
D. cells → organs → tissues → organ systems → organism

Answers

Answer:

B

Explanation:

Because cells make tissues which then combine to make organs which then further combine to form system

Which makes organisms like me and you

Answer: B

(An atom is the smallest unit of matter that retains all of the chemical properties of an element. Atoms combine to form molecules, which then interact to form solids, gases, or liquids. For example, water is composed of hydrogen and oxygen atoms that have combined to form water molecules.)

Explanation : Because cells make tissues which then combine to make organs which then further combine to form system

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

When spindle fibers do not correctly separate the chromosomes during anaphase we get a condition called _________?
A. Duplication
B. Nondisjunction
C. Translocation

Answers

The answer is no disjunction

Explanation:

..........................................

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

Underground water is an example of

A) a hidden water source

B) a untapped water
source

C) an unusable water source

D) a high salinity water source

Answers

Answer:

i think its a hidden water source


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

In order for water to collect in earths atmosphere and form clouds it must first undergo what process?

A) condensation

B) convection

C) evaporation

D precipitation

Answers

Answer:

The answer is D: Precipitation

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

hello please help i’ll give brainliest

Answers

Answer: Clastic sedimentary rocks are made up of pieces (clasts) of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock.

Explanation:

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

son las fallas evidencias de la tectónica de placas de nuestro planeta Y por qué​

Answers

Answer:

you're speaking in the wrong language here

Explanation:

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

Which gas is used by humans in the process of cellular respiration?

Answers

Answer: Oxygen

Explanation:

During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Hope This Helps!

#[tex]AnimePower[/tex]

Answer:

oxygen

Explanation:

we breathe it in during cellular respiration

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

Which of the following is NOT a type of wetland?
a: marsh
b: bog
c: swamp
d: pelagic

Answers

I think it is d because the other places are of course wet lands.

Explanation:

i have no clue, but good luck, hopefully you pass the test

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio​

Answers

The new cell has an increased surface area to volume ratio​ is a process that makes easier the exchange of materials across the surface of the cell (Option C).

What is cell division?

Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.

Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.

In conclusion, news cell has an increased surface area to volume ratio​and it makes easier the exchange of materials (Option C).

Learn more about the cell division here:

https://brainly.com/question/8283140

#SPJ1

A key part of the Watson-Crick model came when Watson realized
that adenine could form hydrogen bonds with thymine and guanine
could form hydrogen bonds with cytosine. This explains why A=T
and G C in Chargaff's rules. Also, these two hydrogen-bonded
nucleotide pairs had the exact same width, so they could form the
rungs of the DNA ladder.
The fact that these pairs could match up only in this way meant that
the sequence of bases in one strand could determine the sequence
of bases in a second strand created from the first. The second strand
is said to be complementary to the first strand. Individual bases are
paired so that the identity of any base determines the identity of the
base paired with it; that is, the complementary base.
This table lists the base abbreviations for bases in a sample of single-
stranded DNA. Fill in the second column with the base abbreviations
that are complementary to the given bases.
I

Answers

Answer:

A–T

T–A

T–A

C–G

A–T

G–C

G–C

C–G

T–A

A–T

Explanation:

A always pairs up with T

C always pairs up with G

A - TT - AT - AC - GA - TG - CG-CC - GT - AA - T

A usually pairs up with TC usually pairs up with GThese are bases of amino acids called nucleotides sequences. And this helps in the bond of several base pairs to their nucleotide sequence.What is the Watson-Crick model?

In “A Structure of Deoxyribose Nucleic Acid,” Watson and Crick defined DNA as a double helix that contained long, helical strands wound together. In their model, every DNA strand contained personal devices referred to as bases, and the bases alongside one DNA strand matched the bases alongside the opposite DNA strand.

Thus it is clear that the above answer is well explained.

To know more about the DNA  refer to the link :

https://brainly.com/question/1328358

_______________________ is an animal's ability to blend into its surroundings.

a
artificial selection
b
evolution
c
natural selection
d
camouflage

Answers

D camouflage I’m assuming because that’s what camouflage is used for.

[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]

Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Other Questions
my mum baked a pie i thought it was an equation am i dum can anyone answer this How would you find the density of a can of soda pop? A. Find the mass of the can of soda pop and then multiply by the number of cubic centimeters in the canB. Find the mass of the can of soda pop and then divide by the number of cubic centimeters in the can C. Convert a gallon into cubic centimeters and then divide by the mass of the can of soda popD. Convert a gallon into cubic centimeters and then subtract the mass of the can of soda pop Please I need help ASAP! I don't know any of the answers. For the second question, I accidentally clicked on it. can i have help please i don't know the answer Fill in the blank in order to form sentences that are found true and correct 7. Quiero ver el menu.quiero ver8 Quiero ver el men.Quiero9 Quieres comprar la casaquieres comprar10 Quieres comprar la casa.Quieres11. Maria debe visitar a nosotros.Maradebe visitar12. Mara debe visitar a nosotros.Maria debe13. Quiero invitar a Mara.Lainvitar14 Cipro invitar a Mara1:10 PE What is the average kinetic energy (temperature) ofsample A write the percent of each figurethat is shaded. What will the change in temperature be when 90 J are applied to 15 g of gold. (Cgold = 0.126 J/gC)Round your answer to the nearest whole number.CE345NextOI 17 short writing:A) Choose two examples from the following areas and explain how they are evidence of globalization. Provide an example from each category.International trade organizationsImmigrationNew technologiesB) Explain one major positive effect and one negative effect of globalization on the United States. Which of the following are solutions to the equation below?Check all that apply.(3x - 5)2 = 19 Edit this for Spanish grammar errors, my last unit was the preterite vs imperfect so the focus is probably there lol. here it isHace dos aos fui a la playa en Florida con mi familia. Incluidos mi hermana, mi madre, mi padre y mi perro llamado Cinnamon. El da era muy caluroso y soleado. En la playa nadamos y jugamos mucho. Tambin tomamos helado del restaurante. Yo tom chocolate y estaba muy deliciosa. Nos quedamos en un hotel cerca de la playa. Lo interesante es que en la playa de repente vimos lo que creo que era un tiburn y sali el agua muy rpido. Me divert mucho all, me entristeci irme y quiero volver algn da. Take a look at the picture. And tell what you think is the answer. Thank you. Assume that Saudi Arabia has production possibilities to produce either 100 barrels of oil using 100 worker hours or 25 bushels of corn using 100 worker hours. If it decides to produce 60 barrels of oil, how many bushels of corn can it produce Who does Leo blame for Stargirls shunning? Describe the people or things below by adding the correct form of the adjective provided. Follow the model: (divertido) Las profesoras de arte son divertidas.(divertido) Los carteles son ____.(difcil) Las clases en la primera hora son _____.(sabroso) Las papas fritas son _____.(fcil) Las tareas de ingls son ______.(deportista) Los chicos son _____.(trabajador) Los profesores son _____.(inteligente) Los estudiantes son _____.(prctico) Las computadoras son _____.(horrible) Los refrescos son ____ para la salud. Which of the words below is an indefinite pronoun? A, ThemB, HeC, MineD, Anyoneand i dont want link or ill report you Each envelope in the class contains the same number of triangles and quadrilaterals. Write an expression thatrepresents the total number of sides in the room. What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio Can someone plz help me plz I beg u plz