What describes a scientific theory

Answers

Answer 1

Answer:

A theory is a carefully thought-out explanation for observations of the natural world that has been constructed using the scientific method, and which brings together many facts and hypotheses. ... A scientist makes an observation of a natural phenomenon.Explanation:


Related Questions

Beets add minerals to the soil. The greens are very good for the compost.

Answers

This is very true, greens and beats add minerals to the soil. But if it grows, it also takes some minerals from the soil.

Which population would most likely survive in a major environmental change?
A. G
B. F
C. H
D. J

Answers

Answer:

H

Explanation:

It has the most variation

Hope that helps

A scientist wants to determine the age of a rock. The rock contains an index fossil and an ancient relative of a living organism. Which is more useful for dating the rock, and why?

Answers

Answer: Ancient Relative of a living organism

Explanation: Ancient Relative because by using the index fossil, you are also using the law of superposition. This law does not give you an accurate/specific date but instead the order they are in (i.e me saying i am older than my siblings compared to me saying i am 2 years older than them). By using an ancient relative of a living thing then we can see its phylogenic tree and measure around how old it is. Fossils also hold carbon and chemicals in there bones which allows us to use carbon dating. Carbon dating is an accurate way of measuring age.

Cortical nephrons have their corpuscles near the _________ edge of the cortex and are the ______ common type of nephron.

Answers

Answer: the first is Peripheral and the second blank is more

what's the difference between a pathogenic virus and a harmless one?

Answers

Answer: Pathogenic viruses end up killing cells; harmless ones don’t.


Yw

fjhkfjkfhklghjlghjkl

Answers

Answer:

lol XD

Explanation:

Imagine that you are managing a large wildlife preserve that was formerly a cattle ranch. You know from historical accounts that wild sheep used to live there, but they were hunted until the local population was exterminated. After doing some research to determine what might be an appropriate starting population, you introduce them. Food is abundant and they have no natural predators. You then spend several years graphing the number of individuals (on the vertical axis) against the number of generations (on the horizontal axis). By the 10th generation, the population begins to reach carrying capacity.

Requried:
What BEST defines this mathematical model used in population studies?

Answers

Being that they don’t have any natural predators by that 10th generation it should be back to normal capacity because of all the hunting. Sometimes humans do things out of convenience because they think that those animals are pests but,sheep aren’t predators and they are actually a very essential part of the animal kingdom in the farms and how they distribute food and kind of take care of each other, other animals and help farmers tremendously. and I mean they’re kind of amazing creatures and they provide a lot of resources for us that there’s it’s not necessary for us to hunt them. We won about 100 head of black Angus beef cattle and we only feed them organic however we won’t kill them unless maybe one has a bad leg or if there’s like an anomaly somewhere other than that he’s happy as most humane as possible and I appreciate your question and I hope it helped.

The mathematical model used in this population study is known as the logistic growth model.

What is logistic growth model?

The logistic growth model is a mathematical model that is used to describe the growth of a population over time. It is based on the idea that the growth of a population is limited by resources such as food, habitat, and space, and that as the population grows, the rate of growth begins to slow. This results in a curve that starts out steep and then levels off as the population approaches its carrying capacity, which is the maximum population size that can be sustained in a particular environment.

In the scenario described, the population of wild sheep is introduced to a wildlife preserve where food is abundant and there are no natural predators. This means that the population is able to grow at a relatively fast rate, but as the population increases, it begins to approach the carrying capacity of the preserve. At this point, the rate of growth begins to slow, and the population levels off.

This is reflected in the graph, which shows the population increasing rapidly at first and then leveling off as it reaches carrying capacity. The logistic growth model is often used to understand and predict the growth of populations in a variety of contexts, including agriculture, biology, and economics.

Learn more about logistic growth model, here:

https://brainly.com/question/28204060

#SPJ5

Describe an approach for understanding global systems and the changes they undergo

IN UR OWN WORDS

ill give brainliest if its in ur own words

50 points :)

Answers

Answer

To understand the global systems and the changes they undergo in a better way, we can use a model to represent the various ecological processes that occur within the biosphere. One example of a model that we can use is the earth systems model. It can show the causes and effects of global change to provide us with insights and learning about the global system as a whole.

Explanation:

Answer:

To be able to understand global systems and their changes first we must survey them before and relook at the systems and analyze how they have changed and what caused these changes.

Explanation:

What types of information can scientists learn from fossils?

Answers

how long life has existed on earth, an idea of an organisms size and how it has changed or evolved, and how some species may have gone extinct

Answer:

Types of information scientists learn from fossils is what it was like back then before we existed, these fossils also tells us our history and we might learn from the history and prevent any disaster that killed that animal or plant from happening to us

Explanation:

Hope this helps!

What is XX and XY? And which are their differences?

Answers

Answer:

chromosomes

Explanation:

the diefference is that one is combination of female genes and the other a combination of female with male genes

What did people previously believe about the movements of Sun and Earth?

Answers

Answer:

They thought of the geocentric theory, or that the earth was the center of the universe

Explanation:

In three to five sentences, describe the advantages and disadvantages of these maps in modeling mitosis.

Answers

In biology, a model can be regarded as representation of the structure and function of biological molecules or maybe an event.

The advantages and disadvantages of these maps in modeling mitosis includes

They depicted the Interphase stages comprising of the G1, S and G2 phases.They also listed  the phases involved in mitosis which is also goodThe other image is depicting mitosis too but there is no title and labeling to it which might be confusing.The models should be able to depict the various activities that occurs during mitosis meaning the second model should have contained labeling to indicate the process of mitosis.The first model should have contained pictorial representations to enable better understanding.

Learn more about models in biology: https://brainly.com/question/2289444

Answer:

The disadvantages for both cells are that neither is an accurate representation of the cell themselves, or the processes. The first cell doesn't tell us exactly what phases the cell is currently going through, and the cell doesn't go through is phases through grey arrows either. However, it does tell us what the phases look like, and the process of how the cell goes through them. The disadvantages of the second map is that, it doesn't show what the phases look like, the advantages are that tells us what the phases are and what comes before and after them, while showing how this occurs in a cycle and keeps going until senescense.

Explanation: Please give me Brainliest! Thank you!

If a chromosome fragment breaks off and then reattached to the original chromosome, but in the reverse direction, the resultant chromosomal aberration is called:

Answers

Answer:

An inversion

Explanation:

An inversion occurs when a chromosome breaks in two places; the resulting piece of DNA is reversed and re-inserted into the chromosome. Genetic material may or may not be lost as a result of the chromosome breaks.

Why does Iceland have geothermal energy?

Answers

Answer:

Due to the geological location of Iceland (over a rift in continental plates), the high concentration of volcanoes in the area is often an advantage in the generation of geothermal energy, the heating and making of electricity. During winter, pavements near these areas (such as Reykjavík and Akureyri) are heated up.

Explanation:

give me brainlist please i need it thank you if you want

Answer:

Due to the geological location of Iceland (over a rift in continental plates), the high concentration of volcanoes in the area is often an advantage in the generation of geothermal energy, the heating and making of electricity. During winter, pavements near these areas (such as Reykjavík and Akureyri) are heated up.

Explanation:

What are some characteristics of animals in “class”


Please help this is for a project pls help it will mean so much for me

Answers

Animals can be classified according to different physical characteristics, such as body covering (e.g., hair, fur, feathers, scales, shells), body shape (e.g., two main features, three main features), appendages (e.g., arms, legs, wings, fins, tails), and method of movement (e.g., walking, crawling, flying, swimming).

Why is it that cancer does not form every time there is a mistake during the cell cycle?

Answers

Answer:

Cells will actually kill themselves through a process called apoptosis, or it will be attacked and killed so it doesn’t spread. For example, when you are exposed to the sun for a long period of time, the solar radiation can mess with your skin cells. That’s why you get sunburned: the cells dry up and fall off. Otherwise, you could get skin cancer

The reason why cancers does not form every time there is a mistake during the cell cycle is explained below:

The following information should be considered:

Cells will actually kill themselves through a process called apoptosis, or it will be attacked and killed so it doesn’t spread. For example, when you are exposed to the sun for a long period of time, the solar radiation can mess with your skin cells. That’s why you get sunburned: the cells dry up and fall off. Otherwise, you could get skin cancer

Learn more: brainly.com/question/16911495

Summarize the lytic cycle. (1 point)

The viral DNA incorporates itself with the host cells and replicates whenever the host cell replicates itself.

A virus copies its genetic material and then splits its cell membranes in half to form identical viruses.

A virus lays eggs on the host cell’s protein coat, which then hatch and move on to infect other cells.


A virus injects its genetic material into the host cell, copies itself, and then forms new viruses that burst out of the host cell.

Answers

Answer: A virus injects its genetic material into the host cell, copies itself using the host's structures and resources, and then forms new viruses that burst out of the host cell

The lytic cycle is one of the two main life cycles of viruses, the other being the lysogenic cycle. In the lytic cycle, a virus infects a host cell and hijacks its cellular machinery to replicate and produce new virus particles, or virions.

The correct option is D .

The lytic cycle is rapid and results in the destruction of the host cell. It is often associated with acute infections, where the symptoms of the infection are more severe and appear relatively quickly. Examples of viruses that follow the lytic cycle include the flu virus (influenza), the common cold virus (rhinovirus), and many bacteriophages that infect bacterial cells.

The lysogenic cycle, on the other hand, is characterized by the integration of the viral genetic material into the host cell's genome, allowing the virus to remain dormant for a period before switching to the lytic cycle.

Hence , D is the correct option

To learn more about  lytic cycle

brainly.com/question/17705456

#SPJ3

Which of the following statements does NOT describe a river delta?
A. sediment that builds up where a river meets a larger body of water
B. some are muddy and unstable; others are so big crops can grow on them
C. earth scooped out that can form a lake or deep valley
D.where a flowing river empties its load at the mouth of a river

Answers

Answer:

C: Earth scooped out that can form a lake or deep valley

Answer:

letter C po Ang answer

Explanation:

please rate brain less

How is computer science helping this scientist do her research?​

Answers

Answer:

Computer and information research scientists invent and design new technology and find new uses for existing technology. They study and solve complex problems in computing for business, science, medicine, and other uses.

Explanation:

Answer:

While following a similar education and career path to that of information systems managers and computer programmers, computer and information research scientists have a specific subset of skills and duties that sets them apart from other computing professionals.

Information research scientists work to advance the field of computing and create new computing-based solutions to problems in countless industries. Their role is as a trailblazer: The development and design of new digital technologies, such as data mining software, is the quintessential duty of a computer research scientist.

Repurposing older technology to work in specific contexts is another frequent activity of a research scientist. They put the “science” into computer science — they research, test, and create, whereas other CS disciplines might focus on information systems management or programming software. Notable historical figures in computing, such as Ada Lovelace and Alan Turing, would be classified as computer and information research scientists today. The advancement of the field is the mission for those in this career.

Due to the broad applicability of computing technology to various fields, computer and information research scientists can be found in almost every industry. From food service to aerospace engineering, nearly every line of work can use these research scientists. As a result, duties for this career can vary greatly.

Many computer research scientists can be found in the field of robotics, where software combines with mechanical hardware to create machines that are more efficient and viable in commercial use. Others might find themselves in the medical field, creating new systems for collating and analyzing patient data. The ubiquity of computing technology means that a typical day for a computer and research scientist is almost impossible to define, and this makes the field quite exciting and dynamic.

There are some common trends that can be defined, however. Computer and information research scientists should expect to become familiar with machine learning and artificial intelligence. This emerging field of computing is perceived as the iconic technology of the future. The demand for computer scientists experienced in machine learning and AI is growing fast. As research scientists, those in this career will be hard-pressed to avoid work that involves AI. Many roles in academic and private settings focused on the research and advancement of artificial intelligence can be found. This field is slowly dominating the focus of many different industries: Automotive, health care, marketing, and even private military companies all have their hands in the world of AI, and that list is growing bigger each day.

The basic idea of the occupation is that information scientists invent new computing technologies in response to various needs. Invention naturally leads to technological advancements in many different lines of work.

what types of solute molecules may be moved by facilitated diffiusion

Answers

Explanation:

Facilitated diffusion therefore allows polar and charged molecules, such as carbohydrates, amino acids, nucleosides, and ions, to cross the plasma membrane. Two classes of proteins that mediate facilitated diffusion are generally distinguished: carrier proteins and channel proteins.

a giant tortoise traveling at 0.3 km/hr would take how many hours to complete a marathon(42km)

Answers

140 h

Explanation:

speed =distance/ time

so rearrange the formula

time= distance/ speed

time = 42/0.3

time = 140 h

Help me please!!!!! ASAP!!! ​

Answers

Answer:

Noncyclic photophosphorylation (top) and cyclic photophosphorylation (bottom). These processes are better known as light reactions.

Glycolysis produces 2 ATP molecules, and the Krebs cycle produces 2 more. Electron transport from the molecules of NADH and FADH2 made from glycolysis, the transformation of pyruvate, and the Krebs cycle creates as many as 32 more ATP molecules.

I'm not sure if that'll help you, but yuhhh!

The amount of available ______ limits the number of trophic levels in a community.
help!!!!

Answers

resources :) take care

ribosomes contain three discrete sites where trnas bind and the polypeptide is synthesized. these are called site (a site), site (p site), and site (e site).

Answers

Answer:

Each ribosomal subunit has three binding sites for tRNA: designated the A (aminoacyl) site, which accepts the incoming aminoacylated tRNA; P (peptidyl) site, which holds the tRNA with the nascent peptide chain; and E (exit) site, which holds the

Explanation:

Each ribosomal subunit has three binding sites for tRNA: designated the A (aminoacyl) site, which accepts the incoming aminoacylated tRNA; P (peptidyl) site, which holds the tRNA with the nascent peptide chain; and E (exit) site, which holds the

When cells go through division in the early stages of life, they are known of stem cells. How do
we end up with all the different types of cells?

Answers

Answer:

these differentiate as a result of signaling mechanisms. ... The daughter cells divides and after each division it becomes more specialized. When it reaches a mature cell type downstream (for example, becomes a red blood cell) it will no longer divide.

Answer:

stem cells are called upon to generate a particular type of cell, they undergo asymmetric cell division.

Explanation:

with asymmetric division, each of the two resulting daughter cells has it's own unique life course

Which ion/molecule in the saliva allows you to taste sugar as sweet? A. Hydrogen ions B. Sodium ions C. Glucose D. Alkaloid molecules​

Answers

Answer:

C. glucose

Explanation:

the presence of energy-rich carbohydrates, such as glucose, which increases the hedonic tone of food and strongly influences our eating behavior.

Glusose is the correct answer

3. A strain of cells undergoes a mutation that increases the permeability of the inner
mitochondrial membrane to hydrogen ions.
a) What effect would you expect this mutation to have on the process of cellular
respiration? 12
b) Assuming the mutant cells can survive, how might the metabolic requirements of
these cells differ from those of a non-mutant strain of the same variety? 12

Answers

A mutation that involves the permeability of the inner mitochondrial membrane to protons (H+) will affect the amount of ATP. If mutant cells can survive, then they will need more energy to create a suitable gradient.

Cellular respiration is a series of metabolic reactions by which aerobic cells can generate energy in the form of ATP by using the chemical energy stored in the foods.

Cellular respiration can be divided into three sequential stages: glycolysis, the Krebs cycle (also called the acid citric cycle) and oxidative phosphorylation.

During oxidative phosphorylation, the transport of electrons across the inner mitochondrial membrane is coupled to the generation of an electrochemical proton (H+) gradient, which is then used to generate ATP by means of a protein complex known as ATP synthase.

Learn more about oxidative phosphorylation here:

https://brainly.com/question/13520255

the global distribution of the diversity of phytoplankton is indicated in the map shown here. which statement best describes the reason for the distribution of different species of phytoplankton as shown here?

PLEASE HELP ME OUT!!

Answers

Answer:

A)Light levels and average temperatures are higher at 0 degrees latitud…

Explanation:

got it right on usa testprep :)

Some midwestern farmland in the United States is covered by

Answers

Answer:

dominant crops

Explanation:

PLZZZZ HELP MEEE I WILL GIVE BRAINLYEST

Answers

What's the question?

I cannot download anything from the internet sorry, so i need the question to be able to answer.

The answer would be choice A
Other Questions
32) 48,504 16 33) Is the sum of 15,398 + 7,292 even or odd? Why? 34) Is the product of 312,234 x 8,987 even or odd? Why? I need all of these answers by today!! Pls help right answer gets brainliest A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5miles an hour in the same direction. How many hours must B travel to overtake A? You can change the ____ or position of text within a document's margins. a. fielding b. proportion c. location d. alignment sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD