tyson is 6 feet 2 inches tall. there are 2.54cm in 1 inch. what is tysons height in centimeters?

Answers

Answer 1

Answer: Tyson is 188 centimetres tall.


Related Questions

A hybrid car can go 400 miles on 8 gallons of gas. How far can the car take you with 1 gallon of gas?​

Answers

Step-by-step explanation:

In 8 gallons of gas the car can go = 400 miles

In 1 gallon of gas the car can go = 400/8

In 1 gallon of gas the car can go = 50 miles

How far can the car take you with 1 gallon of gas?​ With 1 gallon of gas, the car can go 50 miles.

Step by Step calculations:

We know that

With 8 gallons of gas, the car can go 400 miles

Then,

With 1 gallon of gas, the car can go

= 400 / 8

= 50 miles

Therefore, with 1 gallon of gas, the car can go 50 miles.

Learn more here : https://brainly.com/question/10153922

Employee: "We have a promotion that will allow us to beat our competitors' prices and save you money. Did you notice that our competitor is selling that same item for $150.00?
Customer: "Yes"
Employee: "Our price for that item is $120.00, for a savings of __________."10% 15% 20% 30% 40%

Answers

Answer:

20%

Step-by-step explanation:

120 / 150 = 0.8 or 80%, so the difference is 20%

The discount percentage is 20%.

Given that the competitor is selling an item for $ 150.00, while the price for that item in the store is $ 120.00, the following calculation must be performed to determine the discount percentage:

150 = 100 120 = X 120 x 100/150 = X 80 = X 100 - 80 = X 20 = X

Therefore, the discount percentage is 20%.

Learn more about maths in https://brainly.com/question/26075432

The school purchased 35 tickets for the ballet. Adult tickets were $10, and student tickets were $7. The total cost was $266.
If x represents the number of adult tickets purchased, and y represents the number of student tickets purchased, which system of equations represents this situation?

Answers

Answer:

Not too sure, but maybe this is what you need.

(Students = S, Adults = A) So, Ax + Sy = 266?

Or

x10 + y7 = $266

Step-by-step explanation:

I think the second one is the most accurate one, ignore the first equation. T^T

Which angle is the largest?​

Answers

Answer:

the 4th choice

Step-by-step explanation:

hope this helps

MAy I get braineist pls????????

During a storm the temperature drops from 90oF to 75oF. How much did the temperature drop in oC? (Round your answer to the nearest whole number. ).

Answers

15oC that is the answer

A tree trunk can be thought of as a cylinder with a height of 1.7 M if the tree trunk has a diameter of 60 cm what is its volume in metres cubed give your answer to 2 decimal place.

Answers

The formula for the volume of a cylinder is pi * radius squared * height, or πr^2h.

To find the radius of the cylinder, take the given diameter (60 cm) and divide it by 2. 60 / 2 = 30 cm.

Now we need to either find the height in centimeters or find the radius in meters. Because a centimeter is 1/100 of a meter, we multiply the radius by 100 to get the radius in meters.

We also must square the radius. So 30 cm multiplied by itself equals 900 cm.

Radius: 900 / 100 = 9 m

We have to square the radius before plugging it into the equation because it would mess up the numbers if we didn't (0.3 m squared is 0.09 m, which is very small).

Now we can plug these values into the formula for the volume of a cylinder.

π * r^2 * h = π * 9 m * 1.7 m = ~48.066 cubic meters

Rounded to two decimal places is 48.07 cubic meters.

The volume of the tree trunk is about 48.07 cubic meters.

It takes Amy twice as long to deliver papers as it does Nancy. How long would it take each girl to deliver the papers by herself if they can deliver the papers together in 36 minutes?

Answers

Answer:

so if it takes twice all long for amy as nacy that means

Amy takes 2/3 or 0.6(aprox)

Nacy takes 1/3 or 0.3(aprox)

Amy=24

Nacy=12

Hope This Helps!!!

Please help! With steps included :)

Answers

Answer:

Top question: -7°

Bottom question : 18°

Step-by-step explanation:

Top question:

The base angles of am isosceles triangle are congruent:

x + 46 = 39 because the base angles of an isosceles triangle are congruent

x + 46° = 39°

x = -7°

Bottom question

The missing angle is 3x because the base angles are congruent

To find the value of x, we must add all the angles inside the triangle, and find the value of x that makes it equal to 180°

3x + 3x + 4x = 180°

10x = 180°

x = 18°

Sorry for the late post!

-Chetan K

will give brainlyist
What is the quotient of 1 and 7 over 8 ÷ 3 over 8?

Answers

Answer:

5

Step-by-step explanation:

[tex]1\frac{7}{8}\div\frac{3}{8}[/tex]

[tex]=\frac{15}{8}\div \frac{3}{8}[/tex]

[tex]=\frac{15\times \:8}{8\times \:3}[/tex]

[tex]=\frac{15}{3}[/tex]

[tex]=5[/tex]

The quotient is 5.

[tex]\large\underline{\sf{Solution-}}[/tex]

[tex]\textsf{Given that:}\\[/tex]

[tex] \sf1 \dfrac{7}{8} \div \dfrac{3}{8} \\ [/tex]

[tex] \sf \longmapsto \: \dfrac{7 \times 8}{8} \div \frac{3}{8} \\ [/tex]

[tex] \sf \longmapsto \: \dfrac{15}{8} \div \dfrac{3}{8} \\ [/tex]

[tex] \sf \longmapsto \: \dfrac{ \dfrac{15}{8} }{ \dfrac{3}{8} } \\ [/tex]

[tex] \sf \longmapsto \: \dfrac{ \dfrac{15}{8} \times \frac{8}{3} }{ \dfrac{ \cancel \green3}{ \cancel \red8} \times \frac{ \cancel \red8}{ \cancel \green3} } \\ [/tex]

[tex]\sf \longmapsto \dfrac{ \dfrac{15}{8} \times \frac{8}{3} }{1} \\ [/tex]

[tex]\sf \longmapsto \: \dfrac{15}{ \cancel \red8} \times \dfrac{ \cancel \red8}{3} \\ [/tex]

[tex]\sf \longmapsto \: \dfrac{15}{3} \\ [/tex]

[tex]\sf\longmapsto \:\dfrac{15÷3}{3÷3}\\[/tex]

[tex]\sf\longmapsto \:\dfrac{5}{1}\\[/tex]

[tex]\sf\longmapsto \:\boxed{5} \: Answer.\\[/tex]

also read similar questions: Multiply. Write your answer as a fraction in simplest form...

https://brainly.com/question/25825525?referrer

given a1 = -1 and a4 = -8 what is a10

Answers

Answer:

The nth term of the sequence is given. Find the first 4 terms, a10, and a15 2 What is the first term? a1 = (Type an integer or a simplified fraction.) What is the second term? a2 = (Type an integer or a simplified fraction.) What is the third term? a,-| (Type an integer or a simplified fraction.) What is the fourth term? a4(Type an integer or a simplified fraction.) What is the tenth term

Does (–2, –2) make the equation y = x true?

Answers

Answer:

Yes.

Step-by-step explanation:

According to the given co-ordinate.

(x,y) = (-2,-2)

i.e. x = -2, y = -2

So, We can say that x = y = -2.

Hence, the given co-ordinate makes the equation y = x true.

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

Plz help me! 25 POINTS!

Answers

Answer:

  g(x) = 24(2^(x-1)) +16

Step-by-step explanation:

A function is stretched vertically by a factor of 'a' by multiplying by 'a'.

  g(x) = 4·f(x) = 4(6(2^(x-1) +4)

  g(x) = 24(2^(x-1)) +16

Andrew washed 32 car windows in 4 hours. At this rate, how many windows did he wash in 8 hours?

Answers

8 hours is twice as many as 4:

Multiply the number of windows in 4 hours by 2:

32 x 2 = 64 windows in 8 hours

Answer:

64

Step-by-step explanation:

32÷4=8 8 car windows per hour. 8×8=64

if x+y=10 and x-y =6 what is the answer of x cube - y cube fast​

Answers

Answer:

x+y=10 which means that x=10-y

Replace 10-y in the other equation which gives you:

10-y-y=6

10-2y=6

-2y=-4

y=2

Replace 2 in any of the 2 equations same answer for both:

x+y=10

x+2=10

x=8

So,

[tex] {x}^{3} - y^{3} [/tex]

[tex] = {8}^{3} - {2}^{3} [/tex]

=512-8

=504

Hope this helps!

An auto-parts store offers a fuel additive that claims to increase a vehicle’s gas mileage. The additive is poured into a vehicle’s gasoline tank after the tank is filled. To measure the claim, two methods to collect data are proposed.

Method A: 10 similar police cars owned by a city are selected. After the cars are filled with a fresh tank of gasoline, researchers randomly select 10 of the cars to receive the additive, while the other 10 do not receive the additive. The gas mileage for each car is recorded in miles per gallon.

Method B: 20 customers at an auto-parts store receive free coupons for the additive and are asked to use it with their next fresh tank of gasoline. The customers then report their gas mileage with the fuel additive.

Which method describes an experiment?

Method B is an experiment because every car receives the additive.
Method A is an experiment because the additive is used with a new tank of gasoline.
Both methods are experiments because the additive is used in a new tank of gas in both methods.
Method A is an experiment because random assignment determines which cars receive the additive and which cars do not.

Answers

Answer:

Method A is an experiment because random assignment determines which cars receive the additive and which cars do not.

Hit brainliest if this was helpful :)

Method A is an experiment because random assignment determines which cars receive the additive and which cars do not.

What is experiment?

An experiment is a procedure carried out to support or refute a hypothesis, or determine the efficacy or likelihood of something previously untried. Experiments provide insight into cause-and-effect by demonstrating what outcome occurs when a particular factor is manipulated.

What is mileage?

Mileage tells us how many number of miles travelled or covered.

According to questions, an auto-parts store offers a fuel additive that claims to increase a vehicle’s gas mileage. The additive is poured into a vehicle’s gasoline tank after the tank is filled. To measure the claim, two methods to collect data are proposed.

In Method A: 10 similar police cars owned by a city are selected. After the cars are filled with a fresh tank of gasoline, researchers randomly select 10 of the cars to receive the additive, while the other 10 do not receive the additive. The gas mileage for each car is recorded in miles per gallon.

In Method B: 20 customers at an auto-parts store receive free coupons for the additive and are asked to use it with their next fresh tank of gasoline. The customers then report their gas mileage with the fuel additive.

Based on the questions, Method A is an experiment because random assignment determines which cars receive the additive and which cars do not. Method B does not report the mileage before fuel additive.

Hence, we can conclude that Method A is an experiment because random assignment determines which cars receive the additive and which cars do not.

Learn more about experiment  here:

https://brainly.com/question/1759863?referrer=searchResults

#SPJ2

A car is 12 feet long. Levi makes a scale model of the car at 1:8 of its actual size. How long is the model

Answers

Answer:

1.5 feet

Step-by-step explanation:

Answer:

1.5 feet or 3/2 feet

Step-by-step explanation:

Work out the size of angle x.

Answers

Answer:

65°

Step-by-step explanation:

x=180°-40°-75°

x=65°

Question 7
1 pts
Select all sets of points that have a slope m = 2.
(4, 2) and (2,-2)
O (2, -3) and (1,5)
(15, 12) and (5, -8)
(6,5) and (-1,-9)
(2, -3) and (-3,-2)

Answers

Answer:

(4,2) and (2,-2)

Step-by-step explanation:

using m=y2-y1/x2-x1

m= -2-2/2-4=-4/-2

therefore,

m=2

Suppose f(x) = x. Find the graph of f(x) - 5

Answers

Answer:

it's the graph that touches the y-axis in the point (0, -5), and the x-axis in the point (5, 0)

Select the correct answer.
Simplify the following expression.

Answers

this is the answer i believe!! (p.s. cymath is a great website to use for this kind of stuff:)

Three children each contributed toward a birthday present for their mother. The oldest contributed three times as much as the youngest, while the second oldest contributed 50 cents more than the youngest. If the present costs $10.50, how much did each contribute?

Answers

Answer:

Youngest child: $2

oldest child: $6

Second oldest: $2.50

Step-by-step explanation:

Youngest child= x

oldest child= 3x

Second oldest: .50+x

x+3x+.50+x=10.5

5x+.50=10.5

    - .50= - .50

5x=10

divided both numbers by 5 and x is equal to 2. So, the youngest child is $2 and you add .50, which is $2.50, and thats for the second child. Last, you do 2 times 3 equals $6 which is the oldest child.

The youngest contributed $1.90, the oldest contributed $5.27, and the second oldest contributed $2.85.

Three children each contributing to their mother's birthday present. The eldest gave three times more than the youngest, while the second oldest contributed 50 cents more. If the gift costs $10.50 which is given in the question.

What are Arithmetic operations?

Arithmetic operations can also be specified by subtracting, dividing, and multiplying built-in functions.

Let the youngest sibling contribute the amount of x dollars

As per the given information,

3x + 0.50 x + x + x = 10.50

Apply the addition operation,

4.50x = 10.50

x = 10.50 / 6.50

Apply the division operation to get

x = 1.90

So the youngest sibling contributed = $1.90

The oldest contributed 1.90 × 3 = $5.27

And the second oldest contributed (1.50)1.90= $2.85

Therefore, the youngest contributed $1.90, the oldest contributed $5.27, and the second oldest contributed $2.85.

Learn more about Arithmetic operations here:

brainly.com/question/25834626

#SPJ5

how do you write 100 s a fraction, mixed number, or whole number

Answers

In fraction 100/100
In mixed number 10 0/10
Simplest form = 100

I hop this helps! :)

please help anybody hm​

Answers

Answer:

its C

Step-by-step explanation:

im smart

The answer is C I just took the test right now

34x+24x^2=35+57y
Solve for x

Answers

1) Move all terms to one side.

[tex]34x+24x^{2} -35-57y=0[/tex]

2) Use Quadratic Formula.

[tex]x=\frac{-34+2\sqrt{1368y+1129} }{48} ,\frac{-34-2\sqrt{1368y+1129} }{48}[/tex]

3) Simplify solutions.

[tex]x=-\frac{17-\sqrt{1368y+1129} }{24} ,-\frac{17+\sqrt{1368y+1129} }{24}[/tex]

24) If the simple interest on $4,000 for 3 years
is $960, then what is the interest rate?

Answers

Answer:

8% annual

Step-by-step explanation:

first find the rate of 1 year. 960/3 = 320.

then find what % of 4,000, 320 is.

8%

Adam is planning a pool party to celebrate the last day of school. He wants to give out beach towels to his guests as party favors. Adam ordered 14 beach towels from Sunshine Party Supply. Since this was a bulk order, Sunshine Party Supply reduced the price of each towel by $3.25. Adam paid $105 in all. How much does Sunshine Party Supply normally charge for a beach towel?

Answers

Answer:

10.75

Step-by-step explanation:

first step is to find how much adam paid for each towel

so, the equation used will be x/y=c

where x is total cost, y is number of products bought, and c equals individual cost (with discount)

we end up with 105/14= 7.5$ per towel.

and to close out, we add the given discount of 3.25 to the discounted price of 7.5

which brings the usual price per towel to 10.25

Answer:

Step-by-step explanation:

PLEASE HELP!! :( I will mark brainliest!

Answers

Answer:

14 give me that badge :)

Step-by-step explanation:

Answer:

Step-by-step explanation:

14 faces

PLEASE HELP ASAP OF YOU DO FOD BLESS YOU BECAUSE IT WILL RAISE MY GRADE

Answers

Answer:

8

Step-by-step explanation:

The basic form of the equation is y=mx+b. The b stands for the y-intercept. In this equation, 8 is b due to its position in the equation, and -8/7 is m. Since we know that 8 is b and that b is the y-intercept, we know that 8 is the y-intercept.

Hope this helps!

Could someone answer this in y=mx+b form please i cannot figure this out 2x-y=4

Answers

Answer:

y = 2x - 4.

Step-by-step explanation:

2x - y = 4

Subtract 2x from both sides

- y = -2x + 4

Multiply both sides by -1:

y = 2x - 4.

Answer:

y=-2x+4

Step-by-step explanation:

2x-y=4  -  move the 2x to the right side by subtracting 2x from both sides

2x - y = 4

-2x       -2x =

-y=-2x+4  -   negative variable turns into y, since the negative isn't relevant

y=-2x+4

yeah I didn't pay attention today ​

Answers

Answer: 314.3

Explanation: multiply 449 by .30 and then subtract your solution of that to 449 and you will have your new sum
Other Questions
Q). A man x. He gave half of it to his wife, 1/4th to his son and 1200 of his daughter. Form an equation and also find x. Which sentence would improve this conclusion? every town should consider adding bicycle lanes, because it is a great idea. Organizing safety classes for drivers and cyclists will ensure that everyone knows the rules. Do not listen to negative people who complain about anything new. It is true that some people might get injured, but even walking can be dangerous. 1. What is a myth?a) A true story of gods from long agob) A story that often tells a lesson and explains the creation of somethingc) A fictional story based on real people from history.d) A story with taking animals that tells a lesson. PLEASE HELPP!!!! Which process does osmosis involve?A. movement of solute up a concentration gradientB.movement of solute across the cell membraneC. movement of water across a cell membraneD. movement of water up a concentration gradient Observe the cell as it moves from stage to stage through cell division. What trends can you describe about the cell and its internal contents? Question 8 of 10The molecules that make up food contain energy. How does the human bodyget energy from the food molecules?A. By adding energy to the moleculesB. By breaking and reforming chemical bonds in the moleculesC. By using them to form ionic bondsD. By combining the molecules together A garden hose shoots water horizontally from the top of a tall building toward the wall of a second building 20 meters away. If the speed with which the water leaves the hose is 5 m/sec, how long does it take the water to reach the second building, and what distance does the water fall in this time? Understand how to work with negative bases and negative exponents.5^2 = 5^-2 = (-5)^2 = - 5^2 = (Remember to find the base, then multiply.) Does anyone know the answer for this question? I really need it. ______ is an example of a TCS food.A whole watermelonChickenBreadUncooked (dry) rice A piecewise function is represented by the graph below.On a coordinate plane, a piecewise function has 2 lines. The first line is made up of 2 lines. One line goes from (negative 5, 3) to (negative 1, negative 1) and then goes up to a closed circle at (1, 1). The second line has an open circle at (1, 2) and then continues up through (3, 4).What is the domain for the piece of the function represented by f(x) = x + 1?x < 11 x 11 x < 2x > 1 Termina cada conversacin para indicar que la segunda persona est de acuerdo con la primera. 8. Carolina: A m no me gusta limpiar (to clean) la casa. Miguel: A m ____________________________. Immersive Reader(1 Point)tambientampoco Exam GuidelinesExam InstructionsQuestion 4 of 20:Select the best answer for the question.4. Which of the following statements about writing introductions and conclusions is true?O A. Always write the body paragraphs and the conclusion before going back to write the introduction.B. If you have trouble beginning with the introduction, write the body paragraphs first.C. If you're writing a research paper, you don't need an introduction or a conclusion.D. Always write the introduction first and the conclusion last.Mark for review (Will be highlighted on the review page)> Is this statement true or false?Impressionist paintings by John Twachtman depict a moment in time.truefalse What happend when matter condenses??Plzz Answer??? Is this table proportional?XY1 3 34 125 157 21 Your engineering department is asked to evaluate the performance of a new 370-hp sports car. You know that 27% of the engine's power can be converted to mechanical energy of the 1200-kg car, and that the power delivered is independent of the car's velocity. What do you report for the time it will take to accelerate from rest to 60 mi/h on a level road? A geriatric team wants to involve the patients family in his or her care. When is the best time to invite the family to become part of the team?not at allbefore the patients procedureafter the patients dischargeat the very beginning 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Which one is correct