Respiration is a process where many chemical bonds inside the body break and release energy. This energy is used to perform various activities such as moving muscles. Explain the energy transformation in this process.​

Answers

Answer 1

Answer:"Process of breaking down glucose to obtain energy in the form of ATP" also known as Cellular Respiration.

I hope this helps

Explanation:


Related Questions

What is the most valid conclusion regarding ocean depth temperature, based on the data? The temperature and salinity increase with increasing depth. The salinity increases as the depth goes closer to zero. The bottom of the ocean is frozen and salinity levels are low. The ocean temperature never rises above 10°C and salinity remains constant.

Answers

The most valid conclusion concerning ocean depth temperature is B. The salinity increases as the depth go closer to zero.

 

Effect of Salinity on Water Depth

Decreasing ocean temperature increases ocean salinity. These occurrences put pressure on water as the water depth increases with decreasing temperature and increased salinity.

 

What is Ocean Salinity?

Ocean Salinity refers to the saltiness or amount of salt dissolved in a body of water. The salt dissolution comes from runoff from land rocks and openings in the seafloor, caused by the slightly acidic nature of rainwater.

 

Thus, the most valid conclusion one can draw regarding ocean depth temperature is Option B.

Learn more about ocean depth temperature and ocean salinity here: https://brainly.com/question/1512203 and https://brainly.com/question/10335431

In cocker spaniels, solid color (S) is dominant over spotted (s). If a solid male is crossed with a spotted female and they produce all solid colored puppies, the genotypes of the parents must be:

Answers

Answer: the genotypes must be solid that is. if the male is a solid colored genotype

Which of these describes the complexity of abiotic and biotic factors within an ecosystem that supports a specific species?
A.fauna
B.biome
C.climate
D.habitat

Answers

In an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.

What is an Habitat?

An habitat can be described as the sum total of resources, abiotic and biotic factors that are found in a particular environmental area which support the survival and growth of a specific species that is better adapted to it.

Examples of HabitatsWoodland Forest SeashoreGrassland

Therefore, in an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.

Learn more about habitat on:

https://brainly.com/question/931161

The triplet code of bases for RNA may be represented by all of the following except -
F CGT
G CGA
H CGG
O CGU

Answers

Cgt. DNA has the base pairs A,T,C,G, but RNA has A, U, C, G.

water vapor present in air support water cycle

Answers

yes because water is obviously present in the water cycle therefor water is carried up thanks to the air to form a cloud

Pandas eat bamboo for energy. What are pandas classified as

Answers

Answer:

Pandas are classified as herbivores despite their taxonomic classification as a carnivore.

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

One important function of bones is to produce ……………….

Answers

Answer:

Red blooded cell, White blooded cell and platelets

Leukocyte, erythrocytes , platelets

6. All of the following are renewable resources except for:
A. fossil fuels
B. soil
C. water
D. forests

Answers

a - fossil fuels

step by step explanation:

fossil fuels are non-renewable and will run out

A. Fossil fuels

It’s the only one that isn’t renewable

why are the offspring of coral identical to the parent

they reproduce sexually so offspring have increased genetic variation

they reproduce asexually so offspring have increased genetic variation

they reproduce sexually so offspring have decreased genetic variation

they reproduce asexually so offspring have decreased genetic variation

Answers

Answer:

they reproduce asexually so offspring have decreased genetic variation

Explanation:

when an organism reproduces asexually, its offspring will look identical to the parent due to the offspring only receiving genes from one parent. I hope this helps!

Steroids are a type of what?

lipids

carbs

sugar

hormone

Answers

Answer:

lipids

Explanation:

Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help

Answers

A :) lllllllu fluctuating

The biome immediately south of the Taiga is the ______.
(A) Temperate deciduous forest,
(B) Savanna
(C) Tundra
(D) Chaparral.

Answers

Answer:

tundra

Explanation:

Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight

Answers

Bone —> provides structure for the body.

Heart —> pumps blood through the body.

Stomach —> breaks down food into small particles.

Lung —> oxygenates blood.

Pls, help with science (:

Answers

what can i help u ask me if i can i will say you

the empirical (scientific) method of study is based on ______

Answers

Answer:

Empirical research is based on observed and measured phenomena and derives knowledge from actual experience rather than from theory or belief.

Key characteristics of empirical research:

- Specific research questions to be answered

- Definition of the population, behavior, or phenomena being studied

- Description of the process used to study this population or phenomena, including selection criteria, controls, and testing instruments (such as surveys).

NEED ANSWER! WILL BRAINLIST!


•During the mining process, which step immediately follows separating the mineral from the waste rock?


A. refining

B. distribution

C. crushing and milling

D. drilling and blasting

Answers

Answer:

C

Explanation:

How can i earn money from this app?

Answers

Answer:

u dont earn money from brainly. the point is altruistic help

Explanation:

if u mean something else, provide context and ill leave a comment with the correct answer

4
Correct
Drag each label to the correct location on the image.
Name the stages of the water cycle.
condensatio
17
precipitatiom
SIT
evaporation
runoff
Free
groundwat
Next

Answers

Answer:

condensation, precipitation, infiltration, runoff, and evapotranspiration.

condensation, precipitation, infiltration, runoff, and evapotranspiration are the correct steps of water cycle.

what is condensation ?

It is the process by which water vapor is converted into liquid water. It is an integral part of the water cycle.

It shows how water continually converts into three forms solid, liquid, gas throughout the earth surface.

The boiling point and the condensation point are same and take place at 100 degrees Celsius.

The temperature range of condensation occurs between 0 degree Celsius to  100  degree Celsius.

In water cycle due to condensation  water molecule  forms a cumulous clouds and fog followed by fall down of water droplets on the  Earth’s surface as precipitation, which is commonly called rain.

Rain water enters the earth’s waterways, soil absorbed by plants or   freeze into its solid form ice form.

Learn more about water cycle, here:

https://brainly.com/question/9243222

#SPJ5

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

In your own words explain why the sky is blueI

Answers

Answer:

As white light passes through our atmosphere, tiny air molecules cause it to 'scatter'. The scattering caused by these tiny air molecules (known as Rayleigh scattering) increases as the wavelength of light decreases. ... Therefore, blue light is scattered more than red light and the sky appears blue during the day.

Explanation:

Thank You I hope it's helpfull...

Which is a type of mining that is very dangerous but doesn't disrupt much of the surface? A Surface mining B. Strip mining C. Mountaintop removal D. Long wall mining​

Answers

Answer:

Surface mining.

Explanation:

Surface mining can severely erode the soil or reduce its fertility. It can also pollute waters or drain underground water reserves; scar or altar the landscape; damage roads, homes, and other structures; and destroy wildlife.

PLEASE HELP ME ANSWER THIS!!!!!
Outline a heart-healthy “plan” for a person’s whole life: in other words, provide at least two pieces of advice appropriate for a person interested in heart health across their lifespan. Discuss advice appropriate for newborns or very small children; young adults between 18 and 24 years of age; someone in their 40s; and someone over 65. Provide at least one piece of age-appropriate advice specific to the interests, activities, and general health of an average person in each age group.

Answers

A heart-healthy plan for everyone is to eat lots of fruits and vegetables. It's also important to eat low-fat dairy products.

The heart is a vital organ in the body as it keeps the circulation of blood. For children, they should be served fruits and vegetables everyday. They should also eat whole grains.

For adults, they should eat more fish and less red meat. They should also eat lots of fruits and vegetables. Nuts, beans, legumes, and low-fat dairy products are also important for the heart.

Learn more about the heart on:

https://brainly.com/question/75085

What is Ecological Sustainability? What happens if we use all of our planet's resources without replacing them?

Answers

Answer:

Ecologically sustainable development is the environmental component of sustainable development. It can be achieved partially through the use of the precautionary principle. The precautionary principle (or precautionary approach) is a broad epistemological, philosophical and legal approach to innovations with potential for causing harm when extensive scientific knowledge on the matter is lacking. It emphasizes caution, pausing and review before leaping into new innovations that may prove disastrous

Explanation:

All sugars are considered:

a carb

a fat

just sugars

a lipid

Answers

Answer: fat......................................

All sugars are considered as fat.

65 points, anwser asap, graph below

What is happening to the deer population between the years 2005 to 2010? Support with reasoning from our model of population growth.

Answers

Answer:wolves

Explanation:

wolves decreased the population because they kept increasing so people killed the and a couple of years later they went up the so they brought wolves back!

reproduction is not necessary for the continuation of species

Answers

Answer:

It is necessary.

Explanation:

If a member of a species doesn't reproduce, other members of the same species will become extinct.

what's photosynthesis are

Answers

Answer:

Production of sucrose in plants from light energy

Explanation:

WILL GIVE BRAINLEST Why do plants store some of the food they produce?
A. to live through periods when they already have too much food
B.to have tough structures for defense
C.to provide food for other plants
D.to survive periods when they cannot make enough food

Answers

Answer:

D is your answer

Explanation:

there are times when plats cant photosynthesis to make food. So they rely on their food storage so they don't die.

5. What does the pH scale measure and why is this important?

Answers

It measures the relative amount of hydrogen and hydroxyl ions in water. It’s important, because it’s an indicator that is changing chemicals of water.
Other Questions
Help help help history history ASAP Gii phng trnh: 2x + x + 12 =0 Which orbital notation correctly represents a noble gas in the ground state?. What is the purpose of a FiveM Staff Team? When music modulates, it changes _________. Type the correct answer in the boxHow is it possible to understand the flow of data in an organization?Conducting ______ with each team member makes it possible to understand the flow of data in an organization. Help Needed!!! Traveling the Natchez Trace could be very dangerous during the early part of our states history. Discuss the dangers of traveling the Natchez Trace. Could someone help. Please show work Given: ABC, mA=60,mC=45, AB=9Find: Perimeter of ABC,Area of ABC x - y = -4 -5 + 6y = 22The answer is (-2,2) but i just need to show the work for it so please help with that. In 1347, a terrible plague brought death and destruction to Europe.It started in Sicily in 1347. Citizens in the small seaport of Messina began to get headaches. Then camefevers, chills, nausea, and pain. Soon, red blotches appeared on their skin, and the lymph nodes(clumps of tissue) in their armpits and groins swelled to the size of eggs.The nodes grew hard until they turned black andoozed blood and pus. In most cases, death came soonafterward. "It was such a frightful thing." observedGiovanni Boccaccio (Joh-VAHN-neeboh-KAH-chee-oh), an Italian writer, "that when itgot into a house...no one remained. Frightened peopleabandoned the house and fled to another."The gist: Does a tree falling over in a forest make a sound if there is no receptor (human or animal ear) to hear it? In your answer, describe why you think it does or does not. Describe how you would test your hypothesis. Use relevant terms. Please help me , correct answer will get brainiest! Place the events in order from earliest to latest.Pocola Mining acquired lease for commercial digging= Spiro Mounds Archaeological State Park opened= Farmed by Choctaw and Chickasaw Site administration transferred to the Oklahoma Historical Society= University of Oklahoma began scientific excavation Ms.Watson recipe uses 3/4 cups of milk to make 12 cookies how many will it take to make 36 what is 70*77 please help h(x) = x^2 - 5x +7Find h(-5) Help help math straightforward answer ASAP pelsss thanks Convert 4pie/5 to degrees. 135 144 216 225 GIVING 25 POINTS Why wont you ever have a remainder when dividing decimals?