Answer: D
Explanation:
Okay so look at the diagram. Start from the middle and work your way out.
AUG: I find A in the middle (the first four) and then go to the part of the diagram that has U right under the last letter you had, so A. And do the same for U, and you should get methionine.
Repeat this process for the other two.
Which organisms break down decaying organisms and produce an inorganic nutrient pool in ecosystems?
Group of answer choices
secondary consumer
decomposers
primary consumer
producers
Answer:
Decomposers
Explanation:
Decomposers eat decaying or dead organisms to produce the nutrients.
A person is observing the oscillations of a wave. If the wave source begins to move away from the person, what will the person notice?
A.
The wavelength will decrease.
B.
The wave appears to have a different amplitude.
C.
The wave appears to change speed.
D.
The wave appears to oscillate at a different rate.
the wave appears to oscillate at a different rate
DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019
Answer:
Please find the answers to the following questions below:
Explanation:
1. DNA stands for deoxyribonucleic acid
2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.
3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.
4. Three (3) letters are in the code of DNA. These three letters make up a codon.
5. Adenine - Thymine
Cytosine - Guanine
6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC
7. Proteins are a part of the structural composition of the body
Proteins serve as catalyst for biochemical reactions
Proteins are source of nutrients
8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.
9. DNA is a molecule that stores genetic information in the cell of an organism.
20. What is true about the esophagus? Check all that apply.* ]
Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one
Explanation:
Is a bird calls warning for prey a physical or behavioral adaptation?
Is an animals body temperature changing a physical or behavioral adaptation?
Is birds flying to high ground when they sense movement a physical or behavioral adaptation?
NO LINKS! NO PDF'S. Please, help ASAP!
Cuales son las características anatómicas de las fosas nasales
When sea ice melts, there will be a significant amount of sea level rise.
O True
O False
It will be true, since the ice bergas that fall off can be as big as a 98-164 feet. Form what I have resched
What is likely to happen when there is more genetic diversity?
A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving
Answer:
b
Explanation:
if there is more genetic diversity then the organism will adapt much better to the environment around it
Answer:
B
Explanation:
ggggggggggggggggggggggg
HELPPp!!!!!!I’ll mark u brainly
Answer:
Genotypes - Phenotypes:
TT - Thin
Tt - Thin
tt - Wide upside down
LL - Lopsided
Ll - Lopsided
ll - Parallel
VV - Vertical
Vv - Veritcal
vv - Horizontal
PP - Pink
Pp - Pink
pp - Red
Name three reasons why the atmosphere is important to life on earth and explain your reasoning.
The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.
The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.
Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.
Which of the following are not properties of lipids?
Answer: Lipid refers to any class of organic compounds that are considered fatty acids. This also includes their derivatives that are soluble in organic solvents, like many natural oils, waxes phospholipids and steroids.
All lipids have similar properties because their molecules are made of the same elements with similar chemical structure that only varies slightly.
Foods like meat, poultry, seafood, beans, peas and eggs are all sources of proteins, while good that contains saturated fat like palm oil, coconut oil, milk, cheese and coffee creamers and butter contain lipids, that may help in storing energy.
Explanation:
WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?
1. covalent because an electron is transferred from a C atom and O atom to a H atom.
2. covalent because electrons are shared between the C, H, and O atoms
3. ionic because an electron is transferred from a C atom and O atom to a H atom.
4. ionic because electrons are shared between the C, H, and O atoms
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
The atomic no. of carbon=6
Electronic configuration=2,4
The atomic no of H=1
E.C=1
The atomic no of O=8
E.C= 2,6
Therefore to attain octate state, they will share electrons
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
Took the test.
blue, light blue, yellow, or red
HURRY
Answer:blue
Explanation:
please help me with this
Answer:
prob b
Explanation:
Which ingredient is a food acid used to activate baking
soda in quick breads?
o honey
o buttermilk
Answer:
Honey
Explanation:
Technically it could be both, as they can both be acidic, but honey is lower on the pH scale, meaning it is more acidic and thus will have a larger chemical reaction with baking soda.
what is the name of the fluid found in the gall bladder
Answer:
"Bile" is what that fluid is called
There has a been decrease in the diversity of plants in the grasslands of the Edward's plateau. What has caused this to occur?
The natural extinction of a predator can negatively affect the
Environment by leading to
-unrestricted prey species growth.
- major climate change.
-harmful human pollution.
-increased sediment deposits.
Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
I need the answer no links and no putting random stuff I need the answer fast
Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
Explanion:
its already the answer
what does arrows mean in science
Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.
Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.
True or false Biodiversity has both economical and ecological value within an ecosystem.
Explanation:
biodiversity has both economic value and ecological value within an ecosystem. ... Human activities can also threaten biodiversity. These activities include habitat destruction, poaching, pollution, and the introduction of exotic species.
When the ocean absorbs CO2 it leads to what?
Explanation:
Each liquid falls somewhere along a scale with acid at one end and alkaline at the other. Normally, ocean water is less acidic than fresh water. Unfortunately, as the ocean absorbs more and more carbon dioxide from the atmosphere, it becomes more acidic. Lemon juice is an example of an acidic liquid.
Answer:
If the ocean absorbs a lot of CO2 it is most likely to become acidic
Giving brainlist to whoever answers
Answer:
At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.
Explanation:
Answer:
heterotroph
Explanation:
A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?
A.
frequency
B.
wave speed
C.
period
D.
wavelength
Answerd
;-)◑__◐
Explanation:
Please!! I’ll give you lots of points!! PHow do the sensory spines most likely help the cockroach
survive in its environment?
A. They improve the cockroach's vision so it can see
predators sooner.
B. They allow the cockroach to change its body shape
to confuse predators.
C. They reduce the friction along the top of the
cockroach so it can move faster than predators.
D. They allow the cockroach to move through small
spaces where it is unable to use its feet to escape
predators.
pls answer pls please
Answer:
1.it's beak is pointed and slightly curved at pointed
2.it's upper part is brown and lower part is white
3.it's legs is black
Explanation:
What is the difference between a prokaryotic cell and a eukaryotic cell?
Answer:
Size is 0.1- 5.0 um Size is 5-100 um
Nucleus is absent Nucleus is present
Membrane-bound nucleus absent. Membrane-bound Nucleus is present.
Explanation:
here are some
Answer:
One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one
Explanation:
Glad I could help! <3
___________________ is a molecule that organisms get from the air or water around them and use to release energy.
Answer:
Oxygen
Explanation:
In cellular respiration, oxygen is used to break down glucose, releasing chemical energy and heat in the process. Carbon dioxide and water are products of this reaction
why do humans have good memory