production activities include: (check all that apply.) multiple select question. purchasing materials. incurring overhead costs. using materials. production workers assembling products. selling finished products.

Answers

Answer 1

Purchasing accoutrement ,incurring overhead costs, using accoutrements, and product workers assembling products are essential  product conditioning so all option are correct except selling finished product.

Purchasing accoutrements involves buying the necessary raw accoutrements  for  product. Outflow costs include any operating costs that aren't directly related to the  product process but still need to be  reckoned for. Using accoutrements  involves taking the bought accoutrements  and  transubstantiating them into the finished products. product workers assembling products involves the workers physically putting the products together.

Eventually, dealing  finished products involves offering the final product to be bought by consumers. All of these conditioning are essential to any  product process and are necessary for the success of a business.

*To know more about accoutrements visit:

https://brainly.com/question/10284520

#SPJ4


Related Questions

an agent and his customer wish to open a joint account by contributing $10,000 each. all of the following statements are true except the: a account must be approved by the broker-dealer in writing prior to any trading b agent and his customer can agree to share profits in the account as they see fit c agent and his customer must share profit and loss on a 50/50 basis d agreement between the agent and his customer must be documented in writing

Answers

Agent and his customer can agree to share profits in the account as they see fit. The answer is Option B.

What is a customer profit?Agents are not permitted to participate in a customer's account unless a formal agreement between the customer and the agent and approval from the broker-dealer exists. Participation must be proportionate to the capital supplied. Because each person in this situation provided half of the funds, sharing must be done equally.Customer profitability is the profit the company generates by serving a certain customer or set of customers over a given period of time. More precisely, it is the difference between the revenues generated by the customer relationship and the costs incurred during that time. The following formula is used to calculate profitability in customer profitability analysis: Total annual revenue generated x Total profit per client the full amount spent. Analyzing customer profitability can assist identify which clients are profitable.

To learn more about customer profit refer to:

https://brainly.com/question/24553900

#SPJ4

When a company is the first to market with a competitive advantage, this is called a first-mover advantage. All of the following companies were first-movers except ____________.
A) Apple-iPad
B) FedEx-the online self-service software
C) Apple-iPod
D) Microsoft-Bing search engine

Answers

When a company is the first to market with a competitive advantage, this is called a first-mover advantage. All of the following companies were first-movers except Microsoft-Bing search engine. Hence, option D is correct.

The first-mover advantage is a benefit received by a business that releases a good or service on the market first. Before other market entries, a company can build significant brand awareness and customer loyalty by taking advantage of the first-mover advantage.

Being the first usually allows a business to build significant brand awareness and customer loyalty before rivals enter the market. Additional time to refine its good or service and the ability to determine the new item's market pricing are two additional benefits.

To know more about first-mover advantage: https://brainly.com/question/14492873

#SPJ4

the marine corps, within the department of the navby shall serve as an expeditionary force in readiness to perforkm which of the following specific functions is

Answers

The Marine Corps is characterized as an expeditionary force-in-readiness that is staffed, trained, and outfitted expressly to respond swiftly to a wide range of crises and conflicts throughout the complete spectrum of military activities anywhere in the globe. It highlights how naval the troops of the Marine Corps are.

Which three elements make up a Marine expeditionary force?

The Marine Expeditionary Force is the primary warfighting unit of the Marine Corps in major emergencies. Each of the three MEFs in the Corps is composed of land, aviation, and logistical troops.

Being multi-functional rather than specialized, curious rather than complacent, and taking initiative rather than following rules are the right definitions of an expeditionary mindset. In essence, this expeditionary mentality values ingenuity and agility in battle.

Learn more about Marine Corps

https://brainly.com/question/8147229

#SPJ4

causality is one of the most difficult questions to answer and continues to be an important and sometimes perplexing problem for researchers. T/F

Answers

Above statement is correct regarding causality also known as causation.

What’s the difference between correlation and causation?

Correlation does not automatically imply causation, even if causality and correlation might coexist. One thing leading to another is referred to as causation; in other words, action A leads to result B. Contrarily, correlation is only a relationship in which action A is related to action B, but where one event does not always compel the occurrence of the other. Because the human mind enjoys coming up with explanations for events that seem to be connected even when they are not, correlation and causation are frequently misunderstood. When two variables seem to be interdependent, we frequently invent these explanations to explain the relationship. That suggests a cause-and-effect relationship, where one event is the result of another event.

To know more about Causation visit:                    brainly.com/question/15393514

#SPJ4

in order to determine if it is the right time to start a new business, aspiring entrepreneurs must consider the existence of which of the following criteria?group of answer choices A. adequate market demand, small market size, and resources

B. passion, skilled staff, and unmet market need

C. innovative product idea, investors, and favorable market conditions

D. significant market demand, significant market size, and significant resources

Answers

The correct option:  A. adequate market demand, small market size, and resources. Aspiring entrepreneurs must take this into account when deciding whether it is the correct moment to launch a new firm.

Define the term market demand?Because it measures consumer demand for a product at a specific price point, market demand is just a useful tool for businesses. Businesses that take market demand into account can stock the right amount of goods to satiate clients and increase earnings.

Key conclusions:

The desire of customers to buy services or products at a specific price is known as market demand.A product's level of demand can be described using market demand types based on variables like consumer interest.Utilizing tools like demand curve graphs, businesses may determine market demand.

Thus, aspiring entrepreneurs must take adequate market demand, small market size, and resources into account when deciding whether it is the correct moment to launch a new firm.

To know more about the demand, here

https://brainly.com/question/14910739

#SPJ4

in order for an investment adviser to be compensated with a performance fee, all of the following must be disclosed in writing except: a that the fee arrangement may create an incentive for the adviser to make investments that are riskier b that the fee arrangement is based on both unrealized appreciation and realized capital gains c the nature and significance of any index used as a comparative measure and the reason why the adviser believes that any comparative index used is appropriate d that the fee computation can be based on periods ending no earlier than the last day of each calendar quarter

Answers

That the fee system might encourage the investment adviser to recommend riskier assets. The answer is option (a).

What is an investment adviser?

Before signing an advisory agreement that includes a performance fee, the adviser must provide the following written information:

That the compensation model might encourage the adviser to recommend riskier investments.That the compensation for the investment advisor would be based on both realized and unrealized capital gains.The methodology used to value any illiquid assets utilized to calculate unrealized appreciation.The timeframes to be utilized to evaluate performance and their importance in determining the fee; andThe characteristics of any index used to compare investment performance, its importance, and the justification for the adviser's belief that the index is accep table.

To know more about investment adviser, visit:

https://brainly.com/question/20383921

#SPJ4

on friday, betty's grooming paid its employees a total of $2,000. this transaction would have which of the following effects on the accounting equation:

Answers

On Friday, betty's grooming paid its employees a total of $2,000. this transaction would have which of the following effects on the accounting equation: decrease cash increase wages expense

A wage is the sum of money that an employer pays an employee for work that was completed within a certain time frame. The minimum wage, prevailing wage, annual bonuses, and remunerative payments like prizes and tip payments are a few examples of wage payments.Payment by wage contrasts with salaried work, where the employer pays an agreed-upon sum at regular intervals (such as once a week or once a month) regardless of the number of hours worked, with commission, where pay is contingent on individual performance, and with compensation based on the performance of the company as a whole.

To know more about wage here

https://brainly.com/question/1622389

#SPJ4

pure competition pure competition drop zone empty. monopolistic competition monopolistic competition drop zone empty. oligopoly oligopoly drop zone empty. monopoly monopoly drop zone empty. many sellers offering similar products in a marketplace in which they have little control of marketing elements. many sellers offering substitutable products within a price range. a single seller of a product exists. a few companies control the majority of industry sales.

Answers

A monopoly will essentially be the one that stands out and rules the entire demand and supply chain in the particular field of selection, while an oligopoly will allow multiple bosses to coexist.

While monopolistic competition will allow multiple players to enter the market.

What is monopoly without any competition?

A marketing scenario known as pure competition occurs when numerous vendors offer products that are comparable to one another and are priced similarly. Corporations have little control over a product's price in pure competition markets. A monopoly, in which one company has complete price control due to little competition, is the opposite of pure competition.

What is an illustration of a monopolistic rivalry?

Understanding Monopolistic Competition Examples of industries with monopolistic competition include clothing, hair salons, restaurants, and household goods. There are numerous competing businesses that sell, market, and price items like hamburgers or dish soap.

To learn more about Monopolistic Competition here:

https://brainly.com/question/29407851

#SPJ4

Which of the following scenarios are either not accounted for or measured inaccurately by either the income or the expenditure methods of calculating GDP for the United States? Check all that apply.Correct The value of babysitting services, when the babysitter is paid in cash and the transaction isn't reported to the governmentCorrect The variety of goods available to consumersCorrect The loss of enjoyment people incur when scenic land is converted to commercial useCorrect Federal government paychecks to soldiersGDP does not account for off-the-books activities, such as babysitting, which add value to the economy but are not reported to the government. It also doesn't consider the enjoyment households experience as a result of the variety of goods available to consumers. Finally, GDP doesn't take into account the loss of enjoyment people incur when scenic land is converted to commercial use. All of these, though important in measuring the true quality of life within a country, would be far too difficult to measure accurately.Federal government paychecks to soldiers are accounted for in GDP as government purchases.

Answers

The importance of childcare services when the nanny receives payment in cash without disclosing the transaction to the authorities

What is meant by GDP?Babysitting is one of several off-book activities that are not included in the GDP since some of the values and transactions are not added to it.In the US, a lot of individuals receive pay for babysitting, but this money is not added to the economy and does not take into account the losses that result from people losing their enjoyment of things.GDP measures the monetary value of finished goods and services that consumers have purchased and which have been created in a country over a given time period (say a quarter or a year).A nation's entire output is measured within its borders. Typically, a country's gross domestic product (GDP) is used to assess the value added produced via the production of goods and services over a given time period (GDP).As a result, it also accounts for the money made from that manufacturing, or the total amount spent on finished goods and services (less imports).

To learn more about GDP, refer to:

https://brainly.com/question/1383956

#SPJ4

Suppose that the band playing at the rock concert at your school next weekend is playing this weekend at another school. As at your school, the concert sold out quickly, leaving many loyal fans who would still like to buy tickets. There are also some ticket holders who might be willing to sell. Some of these potential sellers can no longer go to the concert. Other ticket holders are only moderately interested in the band and would sell their tickets if the price were high enough. In the graph below, the blue demand curve (circle symbols) shows the willingness to pay for students without a ticket. The orange supply curve (square symbols) shows the reservation price for students with tickets. Use these supply and demand curves to answer the following questions. If the price of a ticket is $50, there will be __
If tickets are free (that is, the price is $0), there will be __
The equilibrium of this market is achieved when __ tickets are sold at a price of __

Answers

If the price of a ticket is $50, there will be - Oversupply . If tickets are free (that is, the price is $0), there will be - shortage of tickets.

1. If the price of a ticket is $50,

Then  the supply = 40 and

demand of ticket = 20.

So, there will be an oversupply of tickets  = 40 - 20

                                                                  = 20 tickets.

2: There will be a shortage of tickets if they are free, or cost nothing.

The demand will be overwhelmingly high and the supply will be negative in this scenario.

3: When 30 tickets are sold at a price of $35, this market reaches equilibrium.

This equilibrium occurs at the intersection of the demand and supply curves. When the price is $35 and there is a demand for thirty tickets, these two curves come to an intersection.

What exactly is a demand-supply curve?

The quantity of a particular product or service that consumers will be willing and able to purchase at each price over a given time period is depicted by the demand curve. The quantities that sellers will offer for sale at each price over the same time period are depicted by the supply curve.

Learn more about demand and supply curve :

brainly.com/question/24324601

#SPJ4

refer to exhibit 4-9. suppose that the government imposes a price ceiling at a price of $10. the number of units that would be exchanged in this market would be group of answer choices 150, since that is the equilibrium quantity and the price ceiling is below the equilibrium price. 220, since that is the number of units demanded at the price ceiling (and the quantity demanded is greater than the quantity supplied). 90, since that is the number of units supplied at the price ceiling (and the quantity supplied is less than the quantity demanded). 155, since that is the average of the quantity demanded and the quantity supplied at the price ceiling.

Answers

Refer to...a price ceiling at a price of $10. the number of units that would be exchanged in this market would be 150, since that is the equilibrium quantity and the price ceiling is below the equilibrium price.

Give a brief account on price ceiling.

The maximum price at which products and services may be offered is referred to as a price ceiling or price cap. It is a form of price regulation and the maximum price that may be charged. When prices appear to be out of control or overly high, it is frequently established by government officials to assist consumers. A price ceiling is something like rent controls, which set a maximum rent that landlords can charge per month for apartments. Another illustration of a typical price ceiling is limits on the price of prescription medications and laboratory testing. A doctor's reimbursement for a procedure, therapy, or office visit is frequently subject to caps set by insurance providers.

To know more about, price ceiling, visit :

https://brainly.com/question/28018539

#SPJ4

The complete question is mentioned below :

Refer to exhibit 4-9. suppose that the government imposes a price ceiling at a price of $10. the number of units that would be exchanged in this market would be group of answer choices 150, since that is the equilibrium quantity and the price ceiling is below the equilibrium price. 220, since that is the number of units demanded at the price ceiling (and the quantity demanded is greater than the quantity supplied). 90, since that is the number of units supplied at the price ceiling (and the quantity supplied is less than the quantity demanded). 155, since that is the average of the quantity demanded and the quantity supplied at the price ceiling.

compensation, as described in your text, refers to the . group of answer choices wage schedules and wage rates listed in the union contract internal alignment of intrinsic awards total of all rewards provided to employees in return for their services wages individuals receive each pay period

Answers

Compensation, as described in the text, refers to the total of all rewards provided to employees in return for their services.

It includes all forms of pay or benefits that an employee receives as a result of their employment, including not only wages, but also bonuses, stock options, health insurance, retirement plans, and other forms of non-monetary compensation.

Compensation can be divided into two categories: direct and indirect. Direct compensation includes wages, salaries, and bonuses, while indirect compensation includes benefits such as health insurance, retirement plans, and other forms of non-monetary compensation.

The text may also mention about the wage schedules and wage rates listed in the union contract, which is one of the components of direct compensation. Internal alignment of intrinsic awards is also a part of compensation, this refers to the rewards provided by the company to its employees for their performance, such as promotions, bonuses, and stock options.

Learn more about Compensation:

https://brainly.com/question/30364497

#SPJ4

1 point question at position 13 (table: optimal choice of yogurt and cheese) use table: optimal choice of yogurt and cheese. the price of yogurt is $2 per unit, and the price of cheese is $4 per pound. hailey's income is $16. if she spends all of her income on cheese, the most she can buy is pounds of cheese, and her total utility will be . table: utility from yogurt and cheese number of yogurts total utility for yogurt pounds of cheese total utility for cheese 0 0 0 0 1 32 1 44 2 60 2 84 3 84 3 120 4 104 4 152 5 120 5 180 6 132 6 204 7 140 7 224 8 144 8 240 (table: optimal choice of yogurt and cheese) use table: optimal choice of yogurt and cheese. the price of yogurt is $2 per unit, and the price of cheese is $4 per pound. hailey's income is $16. if she spends all of her income on cheese, the most she can buy is pounds of cheese, and her total utility will be . table: utility from yogurt and cheese number of yogurts total utility for yogurt pounds of cheese total utility for cheese 0 0 0 0 1 32 1 44 2 60 2 84 3 84 3 120 4 104 4 152 5 120 5 180 6 132 6 204 7 140 7 224 8 144 8 240 4; 22 8; 240 6; 204 4; 152

Answers

The most she can buy is 4 pounds of cheese, and her total utility will be 152.

What is total utility? The complete enjoyment a consumer experiences after consuming a certain commodity or service is known as total utility. There is a marginal utility for each discrete unit of commodities or services. The total utility is equal to the sum of all such objects' marginal utilities.The entire utility of purchasing an item is equal to the sum of money necessary to make the buyer as content as they are now. For instance, the amount of money that would make you as content or happy as eating a chocolate bar may be used to gauge your degree of happiness.

To learn more about utility refer to:

https://brainly.com/question/24922430

#SPJ4

True/False: If the value of dollars is 5.0, the following statement will output 5.00 to the monitor

Answers

It is true that if value of dollars is 5.0, following statement will output 5.00 to monitor.

What is a dollar?

The dollar is a currency used by more than 20 nations. The United States dollar, which was established in 1792 and named after the local currency known as the Spanish dollar, was the first still-existing currency with such a name. The bulk of those currencies are represented by the dollar sign $, just as many other countries that utilise the peso as their unit of exchange. The term "dollar" originally appeared on the 29 g silver Joachimsthaler and Bohemia coins. On the reverse of the coins that the Kingdom of Bohemia began issuing on January 15, 1520, using silver that was extracted nearby at Joachimsthal, the Bohemian lion was incused. Later, in common usage, the town's name for the coins, Joachimsthaler, would be shortened to thaler or taler.

To learn more about dollar, visit:

https://brainly.com/question/14405902

#SPJ4

Identify which country has a comparative advantage in the production of cookies and which has a comparative advantage in the production of milk.

Answers

When making cookies, Atlantis has the clear advantage. New Zealand has a comparative advantage in the production of milk.

What do you know about Atlantis?

Atlantis is a mythical island said to have existed in ancient times. It is usually associated with the legend of the lost continent. According to legend, Atlantis was a powerful and advanced civilization that was destroyed in a single day and night due to a natural disaster. The legend of Atlantis has been around since the time of Plato, and has captivated people ever since. It is believed to have been a utopian society, with advanced technology and a strong government. Throughout history, various theories have been proposed to explain the disappearance of the island, with the most popular being a great flood that submerged it. Despite many attempts to locate the island, it remains lost to this day and its exact location remains a mystery.

So, The required answers are Atlantis and New Zealand.

To learn more about Atlantis:

https://brainly.com/question/16930258

#SPJ4

allowance for doubtful accounts has a credit balance of $800 at the end of the year (before adjustment), and an analysis of accounts in the customer ledger indicates that the estimated amount of uncollectible accounts should be $16,000. based on the estimate

Answers

The adjusting entries which should be made is: Debit Bad Debt Expense, $15,200; credit Allowance for Doubtful Accounts, $15,200. The correct option is B.

What does the provision for questionable accounts' unadjusted balance mean?

The initial amount plus or minus the adjustments create constitutes the allowance for doubtful accounts' unadjusted balance. The amounts recorded by the allowance method which are later recovered or receivables which have been previously written down can all be included in an adjustment.

When you credit allowance for doubtful accounts, you have to estimate what is uncollectible, and you call it bad expense. Your money is moved into a holding account to show that you may not get it. When your mind shifts and you realize you are definitely not going to receive this money, it is doubtful that you will get it. You need to take it out of your minds. To show that you are not going to receive the money, you have to remove it from the allowance for doubtful accounts and credit the accounts receivable.

So, in this case, we need to take it out of this balance as follows:

Allowance for Doubtful Accounts = uncollectible accounts – credit balance

= $16,800 – $800 = $15,200

Now, you had cleared out the allowance for delta accounts, so you would need to reconcile the expense and accounts receivable. To show that you no longer have that expense, you would need to take accounts receivable and credit bad debt expense. To show that you are no longer waiting on the money, you would need to make a second entry into the account to show that you've received cash and a credit. It is depended on whether the company needs to show their ins and outs or not, and sometimes people combine these entries and do it all in once, a debit to cash and a credit to bad debt expense for the transaction.

Learn more about Uncollectible Accounts at: brainly.com/question/14413061

#SPJ4

Although part of your question is missing, you might be referring to this full question: Allowance for Doubtful Accounts has a credit balance of $800 at the end of the year (before adjustment), and an analysis of accounts in the customer ledger indicates the estimated amount of uncollectible accounts should be $16,000. Based on the estimate above, which of the following adjusting entries should be made?

A. Debit Bad Debt Expense, $800; credit Allowance for Doubtful Accounts, $800

B. Debit Bad Debt Expense, $15,200; credit Allowance for Doubtful Accounts, $15,200

C. Debit Allowance for Doubtful Accounts, $800; credit Bad Debt Expense, $800

D. Debit Bad Debt Expense, $16,800; credit Allowance for Doubtful Accounts, $16,800

which of the following is the best example of structural unemployment? which of the following is the best example of structural unemployment? workers enter the labor force because wages are increasing workers quit their current job to go back to school to get better training. workers are fired because the skills they have are no longer valuable. workers are laid off due to a recession new immigrants have a hard time finding jobs

Answers

The best illustration of structural unemployment Examples of structural unemployment include the manufacturing sector and the labour markets for picking fruit.

When the abilities that people in the economy can supply do not match the skills that companies are looking for in employees, structural unemployment results (also known as the skills gap). Changes in the economy, technological advancements, and a lack of individuals with the necessary job skills can all be contributing factors to structural unemployment.

When there is a discrepancy between a worker's skill set and the jobs that are available on the market, unemployment results.

Read more about structural unemployment at

https://brainly.com/question/13685290

#SPJ4

Which of the following is true about intentional infliction of emotional distress? O The defendant's conduct must go beyond all possible bounds of decency and be regarded as atrocious and utterly intolerable in a civilized society. O The plaintiff must have witnessed severe physical injury to a relative or other significant person in the plaintiff's life. O There must be some physical contact with the plaintiff. O Recovery is allowed anytime there is a measurable amount of mental distress.

Answers

"The defendant's conduct must go beyond all possible bounds of decency and be regarded as atrocious and utterly intolerable in a civilized society." The statement is correct.

Intentional infliction of emotional distress (IIED) is a type of tort that involves intentionally causing severe mental distress to another person.

In order for a plaintiff to successfully recover damages for IIED, the defendant's conduct must be outrageous and exceed all bounds of decency. The defendant's conduct must be so extreme that it would be regarded as atrocious and utterly intolerable in a civilized society.

There does not need to be any physical contact with the plaintiff, and the plaintiff does not need to witness any severe physical injury to a relative or other significant person in the plaintiff's life. Furthermore, recovery is not allowed anytime there is a measurable amount of mental distress - the distress must be extreme and the defendant's conduct must be outrageous.

To know more about law here

https://brainly.com/question/6590381

#SPJ4

braxton foods, inc. started using a new preservative in its products. however, it didn't include anywhere on its packaging that this preservative could cause an allergic reaction to people who are allergic to milk products. this is a violation of the consumers' right to

Answers

Answer: Braxton Foods, Inc. violated consumers' right to information and safety.

Explanation: When a company introduces a new ingredient or preservative in its products, it has a responsibility to provide clear and accurate information to consumers. In this case, Braxton Foods, Inc. failed to disclose on its packaging that the new preservative could cause an allergic reaction in individuals who are allergic to milk products. This omission violates consumers' right to information and safety.

US Consumers have 8 consumer rights with the four basic rights first declared in 1962 by US President John F. Kennedy including the two rights listed above.  Later The Food Allergen Labeling and Consumer Protection Act of 2004 (FALCPA) was passed after a random sample of manufactured food products failed to include potential allergens on their labels.  

Learn more about consumer rights here: https://brainly.com/question/24225587.

10 POINTS and brainliest for the best explanation...Can someone clearly explain to me what the three p's in marketing mean?

Answers

The "Three P's" in marketing are Product, Price, and Promotion.

What are the Three P's in Marketing?

Product refers to the goods or services that a company offers. It includes features, design, packaging, branding, and any other element that differentiates it from competitors.

Price refers to the cost of the product or service, and how it is determined. It can include factors such as production costs, competition, and target market.

Promotion refers to the methods and strategies used to communicate and market the product or service to the target audience. It includes advertising, sales promotions, public relations, and personal selling.

Together, the Three P's make up the marketing mix, which is the combination of elements that a company uses to reach its target market and achieve its marketing objectives.

Learn more about marketing here: https://brainly.com/question/25369230

#SPJ1

In a knowledge management system, a knowledge base consists of logical rules that identify data patterns and relationshipsTrue/False

Answers

A knowledge base in a knowledge management system does not consist of logical rules that identify data patterns and connections. So, this is false.

What exactly is a knowledge management system?

A knowledge management system is any type of information technology system that saves and retrieves knowledge in order to increase comprehension, collaboration, and process alignment. Knowledge management systems can be found within companies or teams, but they can also be utilized to centralize your knowledge base for users or consumers. While the definition of knowledge management system is wide, it may be condensed down to the following purpose: to assist individuals in better utilising information to complete tasks. When viewed in this light, it might be reframed as a more proactive type of customer success.

To learn more about knowledge management, click

https://brainly.com/question/29432985

#SPJ4

an invoice is a form that describes the goods or services sold, the quantity and the price, and the terms of the sale. T/F

Answers

TRUE: An invoice is a document that lists the products or services sold, their cost and quantity, and the terms of the transaction.

Explain the term invoice?

Often called a sales invoice, sales ticket, or sales slip, the invoice that serves as an original document for documenting a sale upon account goes by one of these names.

An accounting document known as a sales invoice is delivered by a supplier of products or services to a customer. It keeps track of the goods and services delivered, the money owing by the client, and the accepted methods of payment. Particularly for larger purchases, invoices establish legally enforceable agreements between businesses and customers. Sales invoices assist you with bookkeeping because they are legal records that track that total amount of money entering your company. Sales invoices also offer the following advantages: Tax documentation.

Thus, An invoice is a document that lists the products or services sold, their cost and quantity, and the terms of the transaction.

To know more about the invoice, here

https://brainly.com/question/20796325

#SPJ4

Please answer the question posted in the image below:

Answers

Investments are financial commitments made to acquire assets in the hopes that their value would rise over time. The total value of the investments today is 2104.35

What are assets?

A resource having economic worth that a person, business, or nation possesses or controls with the hope that it would someday be useful is referred to as an asset.

The balance sheet of a business lists assets. They are divided into four categories: tangible, financial, fixed, and current. They are acquired or produced in order to raise a company's value or improve the operations of the company.

Whether it's manufacturing equipment or a patent, an asset can be viewed of as anything that, in the future, can generate cash flow, lower expenses, or increase sales.

Access that other people or companies do not have can likewise be represented as an asset. Additionally, a right or other sort of access may be legally enforceable, meaning a firm may use financial resources as it sees fit.

Learn more about assets, here

https://brainly.com/question/13848560

#SPJ1

question 1 the following file describes the situation faced by a landscaping company, 'landscaping solutions'. if there is great weather, the company takes the following hours to complete a driveway, backyard, front yard, back verandah, and front porch: 20, 30, 25, 25, and 20 hours respectively. good weather increases all times by a factor of 1.1. bad weather increases all times by a factor of 1.25. stormy weather increases all times by a factor of 1.5. a natural disaster increases all times by a factor of 2.0 great weather, good weather, bad weather, stormy weather, and a natural disaster have the following probabilities of occurrence: 0.6, 0.25, 0.1, 0.04, and 0.01 respectively. all these probabilities (weightings) sum to 1.

Answers

The Landscaping Solutions company takes the following hours to complete a driveway, backyard, front yard, back verandah, and front porch in great weather: 20 hours, 30 hours, 25 hours, 25 hours, and 20 hours respectively.

Explanation of complete answer:

In good weather, the company takes 1.1 times longer to complete each task than in great weather, so the hours taken for each task would be: 22 hours, 33 hours, 27.5 hours, 27.5 hours and 22 hours respectively.

In bad weather, the company takes 1.25 times longer to complete each task than in great weather, so the hours taken for each task would be: 25 hours, 37.5 hours, 31.25 hours, 31.25 hours and 25 hours respectively.

In stormy weather, the company takes 1.5 times longer to complete each task than in great weather, so the hours taken for each task would be: 30 hours, 45 hours, 37.5 hours, 37.5 hours and 30 hours respectively.

In a natural disaster, the company takes 2 times longer to complete each task than in great weather, so the hours taken for each task would be: 40 hours, 60 hours, 50 hours, 50 hours and 40 hours respectively.

The probability of each type of weather occurring are: great weather (0.6), good weather (0.25), bad weather (0.1), stormy weather (0.04) and natural disaster (0.01) respectively.

To know more about Probability visit:

https://brainly.com/question/30034780

#SPJ4

kpmg uses all of the following approaches except to handle ethical issues. group of answer choices ensuring consistent investigation and resolution of all reported matters eliminating fear of retaliation for those who raise questions providing multiple channels for raising alarms adopting expedient, site-specific procedures

Answers

The OECD Working Group on Bribery is in its fourth phase of monitoring, which started in 2016. The report is a part of that phase. The nations considered in Phase 4 are examined.

What is the define of monitoring?

monitoring definitions. the action of observing something, occasionally recording it: "In times of conflict, the monitoring of enemy communications plays a crucial role." Observation, observation, and watching types. the practise of observing; a careful examination. The data gathered through monitoring exposes any gaps or problems that need resources to be fixed. It wouldn't be obvious which areas needed to be given emphasis without M&E. It is simple to waste resources in a single place that is not the problem's origin. Monitoring and assessment aid in avoiding this waste.

Know more about considered Visit:

https://brainly.com/question/28144663

#SPJ4

a corporation has issued a 4% $60 par convertible stock with a conversion price of $20. with the preferred stock selling at $66 per share, an investor holding 100 shares of this stock would benefit by converting if the price of the common stock was

Answers

The cost of the common stock per share was higher than $22.

What is Convertible Stock?

A convertible is a bond, preferred share, or other financial asset that allows the shareholder to convert it into common stock.Convertible securities are not categorized as debt or equity; rather, they are viewed as a mixture of the two, possessing the cash flow characteristics of both bonds and stocks.A convertible security is considered to have a conversion premium if it trades above its conversion value. As a result, the security is valued and appealing.Convertible securities have typically done well during periods of rising rates, and recently they have performed as intended, falling much less than the common stock of their issuers.  

To learn more about Convertible Stock refer to:

https://brainly.com/question/23453556

#SPJ4

a business paid dividends to its shareholders. show how to record the transaction to the t-accounts by completing the following sentence. dividends would be

Answers

A reporting organization should credit dividends due on the declaration date and debit retained profits (or any other eligible capital account from which the dividend will be paid) to record a dividend.

The phrase defines how the accounting entries are formatted. On a piece of paper, a giant letter T is originally drawn. Below that, split by the letter's vertical T, debits are reported on the left and credits are recorded on the right. The account name is then printed above the top horizontal line. Transaction identification, journal entry recording, posting of transactions, creation of the unadjusted trial balance, worksheet examination, worksheet inconsistency correction, financial statement preparation, and bookkeeping are the stages of the cycle.

Learn more about Accounting at

https://brainly.com/question/29349684

#SPJ4

A common ethical dilemma faced by the management of Wheel Deals Corporation involves the effect that its decision will have on
a. one group as opposed to another.
b. the firm's competitors.
c. the government.
d. all of the choices.

Answers

The management of Wheel Deals Corporation frequently wrestles with ethical decisions including the impact of their choices on one group vs another. Hence the correct option is A.

An ethical dilemma is one in which a decision must be made between two or more morally right options or between equally wrong courses of conduct when making one decision precludes making the other.

The degree of ethical behaviour in a company is influenced by a variety of individual, societal, and opportunity elements.

The knowledge stage is the initial stage. It starts before you have to make an ethical choice. As suggested by the stage's name, this one is focused on understanding many factors that influence how ethical decisions are made.

To know more about ethical dilemma, click the below link

https://brainly.com/question/28221102

#SPJ4

Consider two neighboring island countries called Sequoia and Glacier. They each have 4 million labor hours available per week that they can use to produce jeans, rye, or a combination of both. The following table shows the amount of jeans or rye that can be produced using 1 hour of labor.

Answers

Sequoia's opportunity cost of producing one pair of jeans is 2 bushels of rye.

Glacier's opportunity cost of producing one pair of jeans is 4 bushels of rye.

How to find the opportunity cost?

To find the opportunity cost of producing jeans to either Sequoia or Glacier, the formula is:

= Bushels of rye produced per hour of labor / Bushels of jeans produced per hour of labor

For Sequoia , the opportunity cost of producing jeans is:

= 24 / 12

= 2 bushels of rye

For Glacier, this is:

= 32 / 8

= 4 bushels of rye

Find out more on opportunity cost at https://brainly.com/question/3611557

#SPJ1

The table and the question is:

Country                        Jeans                                       Rye

                       Pairs per hour of labor               Bushels per hour of labor

Sequoia                          12                                          24

Glacier                            8                                            32

Sequoia's opportunity cost of producing one pair of jeans is____ bushels of rye.

Glacier's opportunity cost of producing one pair of jeans is ____ bushels of rye.

byu given the following information, compute the ending amount of retained earnings. caution: not all of the items listed should be included in the computation of ending retained earnings.

Answers

Calculate the FINAL balance in RETAINED EARNINGS that will be reported on the balance sheet. Account/Debit/Credit Cash/$5,600. Inventory/14,000.

At the end of the period, you can calculate your ending retained earnings balance for the balance sheet by taking the beginning period, adding any net income or net loss, and subtracting any dividends.Cash flow does not appear on a statement of retained earnings All three The components of retained earnings include retained earnings for the initial period,net profit loss realized during the accounting period.The purchase of land does not affect the retained earnings account. Retained earnings refers to the part of profits or earnings that is not distributed to shareholders as dividends.These profits are reinvested in the business for working capital requirements and for the purchase of fixed assets. It can also be used to pay off any type of debt obligations.Inward transports appear in the trade account but not in the balance.

To learn more about earnings balance please click on below link.

https://brainly.com/question/13857300.

#SPJ4

Other Questions
a client who is taking an oral hypoglycemic daily for type 2 diabetes develops an infection with anorexia. which advice will the nurse provide to the client? a solution is prepared at that is initially in dimethylamine , a weak base with , and in dimethylammonium bromide . calculate the ph of the solution. round your answer to decimal places. find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y? this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph? during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to: In order to maintain compliance with standard precautions, a medical assistant should recognize that which of the following tasks requires the use of gloves despite the absence of any visible blood?a) Administering a nebulizer treatmentb) Performing a visual acuity testc) Obtaining a tympanic readingd) Removing a cyst italian sailor credited with the discovery of the americas in 1492. true or false The key idea of John Locke's Enlightenment theory was to protect and enhance the freedoms and rights of O the government. O the philosophers. O the law. O the individual. A group of four friends spends a day at a local theme park, which has just opened a new attraction with very popular rides featuring new technology. They board one of the rides after waiting for over an hour in line, but about five minutes into the ride the electricity fails, and they are stuck on the ride for a half hour. When the ride finally resumes and concludes, they go to the theme parks guest services department to complain. What are the facts?How does the guest feel?How would you acknowledge the guests feelings?What would be your solution?How would you follow up with the guest? Read this quotation from paragraph 10."What could happen if you allowed yourself to step outside the cages and breathe in the fresh air of your freedom?"Based on the quotation, the author views her high-school years as a source of - A. transitionB. confinementC. orderD. discipline