please can you help me

Theme 11. Inflammatory
odontogenic cyst of jaw from deciduous and permanent teeth.Etiology, pathogeny, differential diagnostics, treatment.


1 What cysts are usually associated with the roots of carious or non-vital primary
teeth?
A dentigerous
B radicular
C paradental.
D follicular.
E residual.

2 Reduced regeneration of red blood cells identifies by presence (in blood test):
A atipical lymphocytes
B increasing the number of red blood cells.
C basophilic granulation of erythrocytes.
D poikilocytosis, microcytes with reduced number of reticulocytes.
E incrised level red blood cells sedimentation.

3 What size of bone resorption corresponds cystic formation?
A 8-10 mm
B 5 mm.
C 5-8 mm.
D more 10 mm.
E 10-15 mm.

4 Criteria by which to judge the seriousness of the infection:
A toxic appearance
B local warmth or heat near the caused tooth.

C temperatures elevated to 38.3° to 38.8°c.
D pulse rates of up to 100 beats, respiratory rate is 14 to 16 breaths per minute.
E involvement of extraoral fascial spaces, such as buccal space infections or
submandibular space infections.

5 Primary goal in surgical management of infection is:
A to remove the cause of the infection
B to provide drainage of accumulated pus and necrotic debris.
C removal of caused tooth.
D regional nerve block anesthesia.
E obtaining a specimen of the pus for culture and sensitivity (c&s) testing.

6 Drainage from the abscess cavity has stopped usually:
A 5-6 minutes.
B 2 to 5 days.
C 1-2 hours.
D 5 to 7 days.
E 1-2 days.

7 Indications for antibiotic use in oral surgery:

A severe pericoronitis, with temperatures higher than 100° f, trismus, and some swelling of the lateral aspect of the face

B acute-onset infection with diffuse swelling and moderate-to-severe pain.
C patients who have infections of any severity.
D infection that has progressed to involvement of extraoral fascial spaces.
E all above listed.

Answers

Answer 1

Answer:

B. Radicular cysts are usually associated with the roots of carious or non-vital primary teeth.

D. Reduced regeneration of red blood cells is identified by the presence of poikilocytosis, microcytes with reduced number of reticulocytes.

D. A bone resorption size of more than 10 mm corresponds to cystic formation.

E. The involvement of extraoral fascial spaces, such as buccal space infections or submandibular space infections, is a criterion by which to judge the seriousness of the infection.

B. The primary goal in the surgical management of infection is to provide drainage of accumulated pus and necrotic debris.

D. Drainage from the abscess cavity usually stops after 5 to 7 days.

E. Indications for antibiotic use in oral surgery include severe pericoronitis, acute-onset infection with diffuse swelling and moderate-to-severe pain, patients who have infections of any severity, and infections that have progressed to involvement of extraoral fascial spaces.

Explanation:


Related Questions

5. Earthquakes can cause millions of dollars in damage and can lead to injuries or death.
A. Name two types of damage that can be caused by an earthquake. (2 points)
B. How does an earthquake cause each of these types of damage? (2 points)

Answers

Answer:

A. Two types of damage that can be caused by an earthquake are structural damage and landslides.

B. An earthquake causes structural damage by shaking the ground, which can cause buildings, bridges, and other structures to collapse or sustain damage. Landslides can occur when the ground is shaken loose and gives way, causing soil and rocks to slide downhill. This can damage homes, roads, and other infrastructure in the affected area.

Explanation:

1. The energy from the sun eventually gets stored in fossil fuels.quote? (4 points)
A. What biological process converts sunlight into energy for living organisms? (1 point)
B. What types of energy are involved in this process? (4 points)
C. What events cause the formation of fossil fuels? (5 points)

Answers

Answer:

A. The biological process that converts sunlight into energy for living organisms is photosynthesis.

B. The types of energy involved in photosynthesis are radiant energy from the sun, which is converted into chemical energy in the form of glucose and other organic compounds.

C. Fossil fuels are formed from the remains of dead organisms that have been buried and subjected to high pressure and temperature over millions of years. The process begins with the deposition of organic material such as dead plants and animals in sedimentary rock. Over time, the organic material is buried deeper and deeper, and as the pressure and temperature increase, the material is converted into fossil fuels such as coal, oil, and natural gas. This process is known as fossilization. It can take millions of years for fossil fuels to form, and they are considered non-renewable resources because they cannot be replenished on a human timescale.

Explanation:

A. Photosynthesis converts sunlight into energy for living organisms.

B. Types of energy involved in photosynthesis are solar energy and chemical energy (glucose).

C. Fossil fuels are formed through the accumulation, burial, and transformation of organic matter under heat and pressure over millions of years.

Quote: "The energy from the sun eventually gets stored in fossil fuels."

A. Biological Process: Photosynthesis is the biological process that converts sunlight into energy for living organisms.

Photosynthesis is a vital biological process carried out by green plants, algae, and some bacteria. During photosynthesis, these organisms use sunlight, water, and carbon dioxide to produce glucose (a form of chemical energy) and oxygen. The process takes place in chloroplasts, where pigments like chlorophyll capture sunlight and convert it into chemical energy, which is then stored in the form of glucose.

B. Types of Energy Involved: Photosynthesis involves two types of energy:

Solar Energy: Sunlight provides the energy required for the photosynthesis process. Solar energy is absorbed by pigments in chloroplasts and converted into chemical energy.Chemical Energy: Chemical energy is stored in the form of glucose molecules produced during photosynthesis. This energy-rich molecule is used by plants and other organisms as a source of fuel for various cellular processes.

C. Formation of Fossil Fuels: Fossil fuels are formed through a combination of geological processes over millions of years. The key events leading to their formation are as follows:

Accumulation of Organic Matter: Dead plants, algae, and other organic materials accumulate at the bottom of oceans and swamps over time.Burial and Decomposition: The accumulated organic matter gets buried under layers of sediment, preventing decomposition by bacteria.Heat and Pressure: As more sediment accumulates over the organic matter, heat and pressure increase with depth, initiating the process of fossilization.Conversion to Fossil Fuels: The high heat and pressure transform the organic matter into fossil fuels like coal, oil, and natural gas through processes like diagenesis and catagenesis.

In summary, photosynthesis converts sunlight into chemical energy in the form of glucose, which is then used by living organisms as fuel. Over geological time, the energy captured by ancient plants during photosynthesis has been preserved in fossil fuels, which are essential sources of energy for modern society.

To learn more about fossil fuels, here

https://brainly.com/question/2029072

#SPJ2

Jeannie was studying heredity and drew the illustration shown below.

Image

What is Jeannie showing with the dark lines inside each cell?

Answers

Anything that can be seen inside the nucleus of a cell. Proteins and DNA are organised into genes, which form a chromosome.

What are chromosomes and how many are there?

Chromosomes—threadlike structures made up of protein and a single DNA molecule—are used to carry genetic information from cell to cell. Chromosomes are housed in the nucleus of cells in both plants and animals, including humans.

Each cell normally has 23 pairs of chromosomes. Chromosomes, according to Sutton and Boveri's Chromosomal Theory of Inheritance, are the means by which genetic inheritance is conveyed. Rather, chromosomal behaviour includes segregation, independent assortment, and, on rare occasions, linkage; neither Mendelian genetics nor gene linkage are completely true.

To know more about chromosome visit:

brainly.com/question/1596925

#SPJ9

draw a symbol that depicts the lesson draw a symbol that depicts the lesson discussed explain it by creating an acrostic poem for the word "ADOLESCENCE"​

Answers

We can see here that explaining your lesson by creating an acrostic poem for the word "ADOLESCENCE," we have:

Astonishing, young minds evolving

Dreaming of brighter days in the future

Opposite of adulthood, this is a youth's chance

Learning from experiences that they may encounter

Every lesson teaches them an important trait

Seeking knowledge that will help their future traits

Cherishing each moment with close friends

Enlightening moments that will never end.

What is an acrostic poem?

An acrostic poem is a type of poem in which the first letters of each line are organized to spell out a word or phrase. In an acrostic poem, each line of the poem has a connection to the word or phrase that it spells out.

We can see here that this type of poem is often used as a creative writing exercise or for a special occasion.

Learn more about acrostic poem on https://brainly.com/question/26346712

#SPJ1

Which pair of cities is moving apart as a result of plate motion

Answers

Answer:

.  London, Boston pair of cities is moving apart as a result of plate motion . London situated at the Eurasian plate and Boston in the North American plate

Explanation:

Which part of the body contains bile an enzyme that helps down lipids

Answers

Answer:

liver

Explanation:

The liver produces bile, a solution that helps you digest fats. The gallbladder stores bile. As fatty food enters the upper portion of your small intestine (the duodenum), the gallbladder squeezes bile into the small intestine through the bile ducts.

Regions of the earth that are near the ocean have a different climate than mountainous regions that are far from the ocean. How does the climate in these two regions most likely differ

Answers

Mountainous regions have lower yearly temperatures than regions near an ocean.

Question to answer: Do you feel that the Mcdonaldization of society is problematic or not? Explair
What to include:
At least 5-6 sentences
Your opinion
What should I write about

Answers

Answer:

The McDonaldization of society, a term coined by George Ritzer, refers to the homogenization and standardization of society, particularly in the realm of fast food and consumerism. In my opinion, the McDonaldization of society is problematic because it promotes a culture of conformity, where individuality and diversity are devalued. It also prioritizes efficiency and predictability over quality and uniqueness. The emphasis on speed and convenience has led to the proliferation of unhealthy and unsustainable food options, contributing to public health issues and environmental degradation. Moreover, the McDonaldization of society has resulted in the exploitation of low-wage workers and the concentration of wealth and power in the hands of a few large corporations. Overall, I believe that society should strive to promote diversity, creativity, and sustainability, rather than succumbing to the homogenizing forces of McDonaldization.

Explanation:

How many grams of NaCl are needed to make 3L of a 10% solution?

Answers

To make a 10% solution of NaCl, we need to know the weight of NaCl required for 100 mL of solution. This can be calculated using the formula:

mass of solute (NaCl) = % concentration * volume of solution

Here, we have a 10% solution, which means that for 100 mL of the solution, we need 10 g of NaCl.

To find the amount required for 3 L of the solution, we need to convert 3 liters to milliliters. There are 1000 mL in 1 L, so 3 L = 3000 mL. Now, we can calculate the amount of NaCl required using the formula:

mass of NaCl = % concentration * volume of solution
= 10% * 3000 mL
= 0.10 * 3000 mL
= 300 g

Therefore, we need 300 grams of NaCl to make 3 L of a 10% solution.

2) Table 7.1 shows the results of a study which compared the decomposition of dead D 6.0 ASSIGNMENT-2023 Use data from table 7.1 to support your answer. 2670 Compare the enzyme activity at location A with the enzyme activity at location B.​

Answers

In comparing the enzyme activity of the two locations; at location A, the cellulase activity is higher than at location B, while the protease activity is slightly higher at location A.

What is the comparison of the two locations?

At location A, the protease activity is 2750 µmol min-1 and the cellulase activity is 4790 µmol min-1, while at location B, the protease activity is 2670 µmol min-1 and the cellulase activity is 2500 µmol min-1.

The difference in soil pH at the two locations could be due to variations in the types of vegetation, amount of rainfall, or human activities such as pollution or acid rain deposition.

The difference in soil water content at the two locations could be due to variations in the amount of rainfall, soil drainage, or the proximity to a water source such as a river or lake.

Learn more about soil pH at: https://brainly.com/question/13941039

#SPJ1

Complete question:

Table 7.1 shows the results of a study comparing the decomposition of dead leaves at two locations A and B.

                                              location A location B

protease activity / µmol min– 1 2750       2670

cellulase activity / µmol min–1 4790       2500

soil pH                                      6.0              3.5

soil water content / %              10                  77

(i) Compare the enzyme activity at location A with the enzyme activity at location B

An investigator studies the amount of alcohol produced by yeast when it is incubated with different types of sugars.
What would be Control treatment:

Answers

The experiment's controls include the amount of alcohol present, the incubation environment, and the varieties of yeast utilized.

how alcohol affects the body?

Digestion issues, liver illness, high cholesterol levels, heart disease, and stroke. Cancer of the rectum, liver, colon, mouth, throat, esophagus, and breast. Immune system deterioration increases the likelihood of getting sick. issues with memory and learning, including dementia, and low academic achievement.

Alcohol – a healthy beverage?

Many short- & long-term health hazards, including as blood pressure problems, violent crime, risky sexual behavior, and different malignancies, are linked to alcohol usage. The likelihood of these negative effects grows as your alcohol consumption does.

To know more about Alchohol visit:

https://brainly.com/question/11908844

#SPJ1

If you infect the buffalo population with a disease , how do you predict that will affect the buffalo population ?

Answers

Rinderpest had been suppressing the populations, but once the vaccination program eliminated the disease in cattle, rinderpest also disappeared from Serengeti's wildlife. And that's when the buffalo and wildebeest boomed.

state the difference between a main root and a lateral root​

Answers

The primary root or radicle grows from the seed while the lateral roots come from founder cells in the pericycle or the outermost layer of the vascular cylinder. The primary root in gymnosperms and dicots become taproots that have lateral roots that branch out.

Answer:

The primary root or radicle grows from the seed while the lateral roots come from founder cells in the pericycle or the outermost layer of the vascular cylinder.

If I push on the ground with my foot with a force of 140 N Backwards, what will the force pushing my skateboard be?

Answers

The force pushing your skateboard will be equal in size and the opposite of the force your foot applies to the ground, assuming there is no friction between the skateboard and the ground.

Skateboard: What is Newton's third law?

Newton's first law states that unless another force acts on an item in motion, it will continue to move in the same direction and at the same pace. As long as no force is applied to a rolling skateboard, it will continue to move in the same direction and at the same pace.

What will happen if you're standing on the floor to the force of your body pressing down on it?

Every action has an opposite and equal response, according to Newton's third law. You may not realize it, but when you stand on the ground, you are exerting force against the ground since gravity is pulling you down due to your weight. The floor is pushing back in response.

to know more about skateboard here:

brainly.com/question/30286828

#SPJ1

The volume of Uranus is less than one-tenth of the volume of Saturn.
(the subject does not so the science I needed so I just put biology)

Answers

The volume of Uranus is less than one-tenth of the volume of Saturn. This assertion is accurate.

What are the distinctions between Saturn and Uranus?

Despite having a smaller mass, Uranus has a slightly larger diameter than its neighbor, Neptune. Saturn is the least dense planet, making it the second least dense after that. The methane gas in Uranus' atmosphere gives the planet its bluish-green hue. The cloud tops of Uranus reflect sunlight back out of the atmosphere as it passes through them.

How similar are Saturn and Uranus?

Similarities Between Saturn and Uranus: The atmospheres of both planets are primarily made of hydrogen and helium. Each planet revolves around the Sun. Both have a core that is hotter. They both have several moons.

To learn more about volume of planets visit:

brainly.com/question/16357823

#SPJ1

Below, a pre-mRNA is shown and the complete, edited mRNA is shown. a) in the complete mRNA, use a green pen or highlighter to highlight the methyl G cap. b) In the complete mRNA, use a red pen or highlighter to highlight the poly A tail. c) In both the pre-mRNA and complete mRNA, highlight each exon with diffeent colors, to show the pieces of pre m-RNA that are in both. Heres the pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU. Heres the complete edited mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

Answers

a)Highlight the first nucleotide in green. b) Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red. c) Three exons in pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC".

What is mRNA?

Messenger ribonucleic acid is single-stranded molecule of RNA that corresponds to genetic sequence of gene.

a) Methyl G cap is added to the 5' end of the mRNA, so in the complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA",  first nucleotide is methylated guanine (methyl G) cap. Highlight the first nucleotide in green.

b) The poly A tail is added to the 3' end of mRNA, so in complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA", last several nucleotides are all adenine (A) nucleotides that make up the poly A tail. Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red.

c) Exons are coding sequences of a gene that are kept and joined together after splicing, while introns are non-coding sequences that are removed. Based on given sequences, we can identify three exons in the pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC". In complete mRNA, these three exons are joined together, and intron sequence "CUAUU" is removed.

To highlight exons, we can use three different colors. Let's use blue for  first exon "AUG", orange for second exon "ACCCGGGACGCGCGA", and pink for third exon "UGCCC".

In pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU

Highlighted with different colors for exons:

AUGAACCCGGGACGCGCGAUGCCCUAUU

^^^^ blue ^^ orange ^^^^ pink ^^^^

In complete mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

Highlighted with different colors for exons:

GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

^^^^ blue ^^ orange ^^^^ pink ^^^^

To know more about mRNA, refer

https://brainly.com/question/24885193

#SPJ1

Substance Z is filtered, reabsorbed and secreted. If you were designing a system for
increasing renal excretion of Z when its intake is high, what are some ways this could be
achieved?

Answers

Answer:

To increase renal excretion of Substance Z when its intake is high, the following methods could be employed:

Increase filtration rate: Increasing the filtration rate of the kidneys can help to increase the amount of Substance Z that is excreted. This can be achieved by administering diuretics or increasing fluid intake.

Inhibit reabsorption: Inhibiting the reabsorption of Substance Z in the kidneys can increase the amount that is excreted. This can be achieved by administering specific drugs that inhibit the transporters responsible for reabsorption.

Increase secretion: Increasing the secretion of Substance Z in the kidneys can also increase the amount that is excreted. This can be achieved by administering drugs that stimulate the transporters responsible for secretion.

Alter pH of urine: Altering the pH of urine can also impact the excretion of Substance Z. For instance, increasing the pH of urine can enhance the excretion of weak acids like Substance Z, while decreasing the pH can enhance the excretion of weak bases.

Reduce protein intake: Substance Z may bind to protein in the blood and form complexes that are difficult to filter. Thus, reducing protein intake can lead to a decrease in the amount of Substance Z that is bound to protein, and consequently an increase in its excretion.

Increase physical activity: Increasing physical activity can help to increase blood flow to the kidneys, leading to an increase in filtration rate and excretion of Substance Z.

In summary, to increase renal excretion of Substance Z, one can employ strategies to increase filtration rate, inhibit reabsorption, increase secretion, alter urine pH, reduce protein intake, or increase physical activity. The most appropriate strategy may depend on the specific characteristics of Substance Z and the underlying physiological conditions of the individual.

Explanation:

Question 16 of 25
What is gene flow?
A. Two populations transferring genes
OB. When a population splits in two
OC. Selection for extreme traits
OD. A mutation becoming more common
SUMIT

Answers

A. Two populations transferring genes is gene flow

What alters two populations due to gene flow?

Gene flow has the effect of reducing genetic diversity among populations, inhibiting or delaying the development of populations in various geographic locations into distinct species of the disease.

The frequencies of alleles will fluctuate as a result of gene flow, the transfer of alleles caused by the movement of people or gametes across populations. Evolutionary change, which is frequent in natural populations, comes from deviation from any of these requirements.

Gene flow increases genetic variation when there is a continuum of alleles in the same way that a source of small-effect mutations would.

learn more about Gene flow

https://brainly.com/question/2698940

#SPJ1

What is TRUE of malnourishment?

Malnourishment is only a problem of food quantity.

It only happens when a person doesn't get enough calories.

It can occur when people get enough calories, but not enough of one or more key nutrients.

People who get too many calories cannot be malnourished.

Answers

It is an imbalanced between the nutrients your body needs to function and the nutrients it gets

Your answer would be B "it only happens when a person doesn't get enough calories


Malnutrition is an imbalance between the nutrients your body needs to function and the nutrients it gets. It can mean undernutrition or overnutrition. You can be malnourished from an overall lack of calories, or you might have a protein, vitamin or mineral deficiency.

Cellular respiration and photosynthesis are processes that transfer energy and cycle matter. Explain how each process transfers energy, and how energy transfers from one form to another throughout the process. Then explain how each process cycles carbon for the Earth.

Answers

Answer

The carbon cycle is nature's way of reusing carbon atoms,

Explanation:

The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms. Carbon moves from plants and animals to soils. When plants and animals die, their bodies, wood and leaves decays bringing the carbon into the ground. Some is buried and will become fossil fuels in millions and millions of years. Carbon moves from living things to the atmosphere.

Explain Continental Drift Hypothesis (pangaea and Sea Floor Spreading (Hess)

Answers

Answer:

The Continental Drift Hypothesis, proposed by Alfred Wegener in 1912, suggests that the Earth's continents were once joined together as a single supercontinent called Pangaea. According to the hypothesis, Pangaea began to break apart around 200 million years ago and its pieces slowly drifted to their present positions over millions of years.

Wegener's theory was based on several lines of evidence, including the fit of the continents, the distribution of fossils, and the matching of rock types and mountain ranges across different continents. However, at the time, he was unable to explain the mechanism by which the continents moved.

In the 1960s, the theory of sea floor spreading was proposed by Harry Hess, which provided an explanation for the movement of the continents. Sea floor spreading is the process by which new oceanic crust is formed at mid-ocean ridges and then moves away from the ridge, carrying the continents with it.

According to the theory of sea floor spreading, the Earth's lithosphere (the rigid outer layer of the Earth) is divided into a series of tectonic plates that move slowly over the underlying mantle. As magma rises to the surface at mid-ocean ridges, it cools and solidifies to form new oceanic crust. As this new crust forms, it pushes the existing crust away from the ridge, causing the continents to move.

The evidence supporting the theory of sea floor spreading includes the distribution of magnetic stripes on the ocean floor, which suggest that the Earth's magnetic field has reversed itself many times in the past. These magnetic reversals are recorded in the rocks on either side of the mid-ocean ridges, providing evidence for the movement of the tectonic plates.

Overall, the Continental Drift Hypothesis and the theory of sea floor spreading provide a compelling explanation for the movement of the Earth's continents over millions of years.

What happens when matter changes in size or shape only?

A) A psychical change
B) A chemical change​

Answers

answer

A psychical change

A) physical change. This should be correct

what climates are temperate continental? i need it answered before 10 pm est ​

Answers

Answer:

Temperate continental climates are typically found in the middle latitudes of the northern hemisphere, particularly in the interior regions of continents. Some examples of regions with temperate continental climates include:

The Great Plains region of North America, which includes parts of the United States and Canada

The interior regions of Europe, including parts of Germany, Poland, and Russia

The central and eastern regions of China

The central and southern regions of South America, including parts of Argentina and Uruguay

The interior regions of Australia, including parts of New South Wales and Victoria.

Temperate continental climates are characterized by four distinct seasons, with hot summers and cold winters. They typically have low to moderate precipitation levels and can experience significant temperature fluctuations throughout the year.

Answer: Regions with mild and continental climates are also called temperate regions. Both climate types have distinct cold seasons. In these parts of the world, the climate is influenced mainly by latitude and a region's position on the continent. Mediterranean climates have warm summers and short, mild, rainy winters.

Which scenario describes a relationship of commensalism

Answers

In an ecological interaction known as commensalism, one creature benefits while the other is neither aided nor hurt.

When a bird builds its nest in a tree, that is an example of a commensal relationship. The bird gains from having a secure location to erect its nest, while the tree receives neither assistance nor injury. The bird's nest has no impact on the tree's ability to grow and operate correctly.

In this relationship, the tree serves the bird's needs while the tree itself is unharmed. One creature gains, while the other is neither aided nor hurt, making this a commensalism example.

To learn more about commensalism:

https://brainly.in/question/8944221

4. Which best describes a diagram of evolution? sc.7.L.15.2​

Answers

Answer:

The best description would be a bush.

Explanation:

Evolution resembled a tree, with a trunk branching off into different branches, which branch off into smaller branches, etc. This is basically the same as a bush. Any kind of line that's just a line, without any branching out, doesn't properly represent evolution because it only follows one line of evolution instead of accounting for the full picture.

what kind of spider is this, it's on a wild daffodil. I've named it Monica.​

Answers

Answer:

Long leg sac spider

Explanation:

Because it has long legs and the back looks like a sac hope this helps

List 5 establishments or firms related in hospitality business that uses the green supply management to cater to their costumer yet to achieve costumer satisfaction and name the items or supplies

Answers

Answer:

Explanation:

dxesrtgbm xzetfg

Answer:

Here are 5 establishments/firms related to the hospitality business that use green supply management:

1. Marriott International - This hotel chain has committed to sustainable sourcing for a variety of items, including seafood, coffee, and cotton.

2. Hilton Worldwide - Hilton is committed to sustainable sourcing of seafood, palm oil, and paper products, among others.

3. InterContinental Hotels Group - This hotel chain is committed to sustainable sourcing of seafood, coffee, and palm oil.

4. Starbucks - While not strictly a hospitality business, Starbucks is a major supplier of coffee to many hotels and restaurants. The company has committed to sustainable sourcing of coffee beans and paper products.

5. Whole Foods Market - This grocery chain supplies many hotels and restaurants with organic and sustainably sourced produce, meat, and other food items.

Human Pedigree chart crossword puzzle

need the answers thank you

Answers

The correct options for the crossword puzzle in the human pedigree are:

Across

5. A circle or square that has a diagonal line across the front means that person is deceasedA bracketed circle or square with a capitol "A" inside means that person is affected/carrierA circle and a square that are connected by a straight line but also has 2 diagonal slashes on the line, means they are divorcedA diamond shape that has two dashes for edges and a capital "P" inside represents a pregnancyThe person making the chart has an arrow pointed to them. They are called the probandWhen you look at a pedigree, and mostly males and very few females are colored in, you could guess that the condition is X-linked recessive

Down

A circle that is only half-colored means that is a female carrierA male is represented by a squareA circle or square that is fully colored in means that individual is affectedA straight line connecting a circle and square means they are marriedIf only males exhibit the condition in a pedigree, then the trait is carried on the Y chromosome (2 words)A female is represented by a circle

What is a human pedigree?

A human pedigree is a diagram that depicts the family relationships and transmission of an inherited trait or disease within a family over several generations. In a pedigree, males are represented by squares, and females are represented by circles.

The symbols in a pedigree can indicate whether an individual is affected by the trait, whether they are a carrier, or whether they are unaffected. The pedigree can be used to analyze the mode of inheritance, whether it is autosomal dominant, autosomal recessive, X-linked dominant, or X-linked recessive.

Pedigrees are an important tool in genetic counseling and can help identify individuals at risk of inheriting or transmitting a genetic disorder.

Learn more about human pedigree at: https://brainly.com/question/14001905

#SPJ1

how did the sea urchin population change over time in areas with otters?

Answers

Answer: The sea otter decline set off a trophic cascade in which the coastal marine ecosystem underwent a phase shift from kelp forests to deforested sea urchin barrens. This interaction in turn affected the distribution, abundance, and productivity of numerous other species.

Sea otters will use sea urchins as their food source, and sea urchins will eat kelp. This indicates that a higher number of sea otters will consume more sea urchins, which will decrease their number. A low number of sea urchins will consume less sea kelp, and hence, their number will be higher.

3. Stratigraphy helps paleontologists understand the sequence of events in Earth's history.
A. What are two of the principles of stratigraphy? (4 points)
B. How is each principle used to make it easier for geologists to understand Earth's past? (6
points)

Answers

Answer:

Law of Superposition - This principle states that in a sequence of undisturbed sedimentary rocks, the oldest rocks are at the bottom and the youngest are at the top. This principle allows geologists to determine the relative ages of rocks and fossils based on their positions within the rock layers.

Principle of Original Horizontality - This principle states that sedimentary rocks are originally deposited in horizontal or nearly horizontal layers. Any deviations from this horizontal orientation are the result of subsequent geological events, such as folding or faulting. This principle allows geologists to identify rocks that have been tilted or overturned, which can provide clues to the tectonic history of an area.

B. The Law of Superposition and the Principle of Original Horizontality are used in the following ways to make it easier for geologists to understand Earth's past:

Dating of rocks and fossils - By applying the Law of Superposition, geologists can determine the relative ages of rocks and fossils within a sequence of sedimentary rocks. This information can be used to construct a geological time scale, which provides a chronological framework for Earth's history.

Interpretation of depositional environments - The Principle of Original Horizontality helps geologists to interpret the depositional environments in which sedimentary rocks were formed. By analyzing the sedimentary structures and fossils within the rocks, geologists can reconstruct the ancient environments in which they were deposited, such as river channels, deltas, or shallow marine environments.

Identification of geological events - Both principles can be used to identify geological events that have affected the sedimentary rocks, such as folding, faulting, and erosion. By analyzing the orientation of rock layers and the relationships between different rock units, geologists can reconstruct the geological history of an area and infer the types of tectonic forces that have shaped it.

Explanation:

Answer:

A. Two of the principles of stratigraphy are:

Law of Superposition: This principle states that in a sequence of rock layers, the oldest rocks are found at the bottom, and the youngest rocks are found at the top.

Principle of Faunal Succession: This principle states that different rock layers contain different fossil assemblages that succeed each other vertically in a predictable order.

B. Each principle is used to make it easier for geologists to understand Earth's past in the following ways:

Law of Superposition: This principle allows geologists to determine the relative ages of rock layers, even if they are not in the same location. By comparing the rock layers in different locations, geologists can create a timeline of Earth's history and understand how different events occurred in different places at different times.

Principle of Faunal Succession: This principle allows geologists to use fossils to date rock layers. By examining the fossil assemblages in different rock layers, geologists can determine the relative ages of those layers and create a more precise timeline of Earth's history. This principle is also useful for correlating rock layers between different locations, as similar fossil assemblages can indicate that two rock layers are of similar age.

Overall, the principles of stratigraphy provide geologists with a framework for understanding the sequence of events in Earth's history. By using these principles to analyze rock layers and fossils, geologists can create a more complete picture of the past and better understand how our planet has changed over time.

Explanation:

Other Questions
What is the range of the function f(x) = |x| 3? {f(x) | f(x) 3} {f(x) | f(x) < 3} {f(x) | f(x) 3} {f(x) | f(x) > 3} What is the tone in two minutes by phillip What is the product of 3x 4 and 5x^22x+6. Write your answer in standard form.Part a: SHOW WORKPart b: Is the product of 3x 4 and 5x^22x+6 equal to the product of 4 3x and 5x^2 2x + 6? EXPLAIN.20 points, please show work. Thanks. new car dealer owner encourages the staff to maintain records on customer purchases. the goal is for the staff to contact these customers every three years to present new car models face-to-face. what type of promotion is this owner encouraging? public relations influencer marketing personal selling traditional advertising Management proposed the following regression model to predict sales at a fast-food outlet.y = 0 + 1x1 + 2x2 + 3x3 + wherex1=number of competitors within one milex2=population within one mile (1,000s)x3=1 if drive-up window present0 otherwisey=sales ($1,000s).The following estimated regression equation was developed after 20 outlets were surveyed. = 10.9 4.2x1 + 6.8x2 + 15.7x3(a) What is the expected amount of sales (in dollars) attributable to the drive-up window?$(b) Predict sales (in dollars) for a store with four competitors within one mile, a population of 8,000 within one mile, and no drive-up window.$(c) Predict sales (in dollars) for a store with one competitor within one mile, a population of 3,000 within one mile, and a drive-up window.$ sherpath a 38-year-old patient declines prenatal diagnostic testing as result of a lack of family history of genetic or chromosomal abnormalities. which nursing education is appropriate for this patient? What is the answer ?? Please help will mark Brainly 4. What is the area of the kite? Round to the nearest tenth. 905 in5 in. 6017. 1 in27. 1 in 2ObOd23. 4 in212. 4 in2 tkam Using textual evidence, research Miss Stephanie Crawfords understanding of Boo Radleys story. What happened? What is Boos story, according to Miss Stephanie Crawford? (see pages 11-12) 1. Analyze two passages about the Atlantic slave trade and then answer the questions. Passage 1: Olaudah Equiano This passage is from the autobiography of Olaudah Equiano, an African man sold into slavery. The first object which saluted my eyes when I arrived on the coast was the sea, and a slave ship . . . waiting for its cargo. These filled me with astonishment, which was soon converted into terror. . . . I was immediately handled and tossed up to see if I were sound by some of the crew; and I was now persuaded that I had got into a world of bad spirits, and that they were going to kill me. . . . I was soon put down under the decks, and there I received such a salutation in my nostrils as I had never experienced in my life: so that, with the loathsomeness of the stench, and with my crying together, I became so sick and low that I was not able to eat. . . . I now wished for the last friend, death, to relieve me; but soon, to my grief, two of the white men offered me eatables; and, on my refusing to eat, one of them held me . . . and laid me across I think the windlass, and tied my feet, while the other flogged me severely. . . . But still I feared I should be put to death, the white people looked and acted, as I thought, in so savage a manner; for I had never seen such instances of brutal cruelty; and this is not only shown towards us blacks, but also to some of the whites themselves.Passage 2: Alexander Falconbridge This passage is a firsthand account of a British doctor who worked aboard slave ships. He later became an advocate for ending the slave trade. On being brought aboard the ship, [the men] are immediately fastened together, two and two, by hand-cuffs on their wrists and by irons riveted on their legs. They are then sent down between the decks and placed in an apartment partitioned off for that purpose. The women also are placed in a separate apartment between the decks, but without being ironed. An adjoining room on the same deck is appointed for the boys. Thus they are all placed in different apartments.Questions:a. What is one historical argument a historian might make about the Atlantic slave trade based on these sources? b. What is one similarity and one difference in the way the two sources interpret the events described? Which element "X" forms an ionic compound with the formula X3P2? Simplify 7/12 + 5/18 = pls explain bcs i have a test tomorrow Help me please thank you if you do If AB represents 300%, what is the length of a line segment that represents 100%? Which one of the following factors is not involved in ideal gas law? Im confused, how do I create a dot-plot with only one number in the tens? Baylie, you 16 inches of tape to make a square on the floor. She made a rectangle with the same amount of tape and has a width 1/2 of the square what is the length Please ASAP HelpWill mark brainlest due at 12:00