Answer:
I would say that this would cause "overgrazing on public lands."
Explanation:
When people see that the fees are cheaper, they would send their livestock there. It might be alot of livestock though
Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
Answer:
CCGATAGGT
Explanation:
got this for my hw.
Answer:
So the central dogma of molecular biology describes the journey from DNA to protein product:
DNA --transcription--> mRNA --translation--> Protein
Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).
In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.
5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’
We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:
mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.
Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.
To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.
5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu
Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.
In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.
Explanation:
n
In which state elements occurs?
An element is said to exist in free state if it does not combine with any other element. Rather, free state elements are stable even without combining.
Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight
Bone —> provides structure for the body.
Heart —> pumps blood through the body.
Stomach —> breaks down food into small particles.
Lung —> oxygenates blood.
How and why does the surface of the earth change
of the earth has changed?
Answer:
How and why does the surface of the earth change
of the earth has changed?
It can be hard to describe change on the surface without bringing up the interior. Earth is a system of constantly changing interactions between interior, surface conditions, and external events.
Volcanoes bring up new material and even create land. The Hawaiian islands, for instance are a chain of volcanoes on the surface, but the underlying structure is a single magma plume. In a way, the entire chain of islands is a single volcano that breaks through different places as the crust moves over it.
On that note: plates. Earth is made of tectonic plates that constantly move. Some grind against one another, others collide, and some pull apart. Depending on direction and interaction, you get anything from mountains, to spreading valleys, oceans, and anything else you care to name. Mountains can almost be viewed as something akin to the ridges of build up ice on a window scraper.
Erosion by water, wind, sand, chemicals, and living things changes the surface too. Materials on the surface face an incredible number of forces breaking them down and dragging them away, even as those same forces in different places and situations deposit those materials in other places, building things back up.
“Stardust” is also a thing. Rocks, dust, debris, and all sorts of random, natural cra.,p is constantly hitting our atmosphere. Regardless of whether or not it stays mostly intact, some material breaks off, and most of it does tend to make it to the surface, adding tiny amounts of matter all the time. …of course something BIG enough hitting the surface can throw rocks and chunks of surface clear into space, so that’s a thing too.
Remember when I mentioned living things? Living things D.,IE! Gac.k! And when they do, they break down into organic gunk. Soil - the stuff we grow crops in - is basically minerals and dead things that are decaying into nutritious, yummy, dir.,t.
Weather changes things too. Rain erodes, but rain that soaks a rock, and then is frozen by low temperatures, breaks the rock. Too much rain can create flooding, which results in a lot of sediment moving downstream. Heat can dry things out, crack the ground, and even slowly cook one kind of soil into another. Lightning can make glass out of sand, snow can collapse weak ground, not enough rain can dry out ground that could si.nk down without the extra pressure, and too much rain can literally move mountainsides if enough water adds its weight to the rocks and dir.t.
It’s always changing, and there is always more complexity to go into when studying it. There’s seldom a single cause, or reason, or effect for anything.
Explanation:
Have a great day!
The surface of the earth is constantly changing.
Explanation:
Wind, water,and ice break down large rocks and move sediments on the surface. Some events, though, change earth's surface much more quickly. These include volcanic eruptions, earthquakes, and landslides.
Proteins are synthesized based on genetic information carried by DNA. Explain In you’re own words how the structure of DNA is important in the
synthasis of different kinds of proteins, In your explanation, include a description of the two main processes involved in
protein synthesis.
Answer:
Explanation:The synthesis of proteins occurs in two sequential steps: Transcription and Translation. Transcription occurs in the cell nucleus and uses the base sequence of DNA to produce mRNA. The mRNA carries the message for making a specific protein out to the cytoplasm where translation occurs.
water vapor present in air support water cycle
What is the most valid conclusion regarding ocean depth temperature, based on the data? The temperature and salinity increase with increasing depth. The salinity increases as the depth goes closer to zero. The bottom of the ocean is frozen and salinity levels are low. The ocean temperature never rises above 10°C and salinity remains constant.
The most valid conclusion concerning ocean depth temperature is B. The salinity increases as the depth go closer to zero.
Effect of Salinity on Water Depth
Decreasing ocean temperature increases ocean salinity. These occurrences put pressure on water as the water depth increases with decreasing temperature and increased salinity.
What is Ocean Salinity?
Ocean Salinity refers to the saltiness or amount of salt dissolved in a body of water. The salt dissolution comes from runoff from land rocks and openings in the seafloor, caused by the slightly acidic nature of rainwater.
Thus, the most valid conclusion one can draw regarding ocean depth temperature is Option B.
Learn more about ocean depth temperature and ocean salinity here: https://brainly.com/question/1512203 and https://brainly.com/question/10335431
why are the offspring of coral identical to the parent
they reproduce sexually so offspring have increased genetic variation
they reproduce asexually so offspring have increased genetic variation
they reproduce sexually so offspring have decreased genetic variation
they reproduce asexually so offspring have decreased genetic variation
Answer:
they reproduce asexually so offspring have decreased genetic variation
Explanation:
when an organism reproduces asexually, its offspring will look identical to the parent due to the offspring only receiving genes from one parent. I hope this helps!
Steroids are a type of what?
lipids
carbs
sugar
hormone
Answer:
lipids
Explanation:
Pandas eat bamboo for energy. What are pandas classified as
Answer:
Pandas are classified as herbivores despite their taxonomic classification as a carnivore.
what's photosynthesis are
Answer:
Production of sucrose in plants from light energy
Explanation:
65 points, anwser asap, graph below
What is happening to the deer population between the years 2005 to 2010? Support with reasoning from our model of population growth.
Answer:wolves
Explanation:
wolves decreased the population because they kept increasing so people killed the and a couple of years later they went up the so they brought wolves back!
The biome immediately south of the Taiga is the ______.
(A) Temperate deciduous forest,
(B) Savanna
(C) Tundra
(D) Chaparral.
Answer:
tundra
Explanation:
reproduction is not necessary for the continuation of species
Answer:
It is necessary.
Explanation:
If a member of a species doesn't reproduce, other members of the same species will become extinct.
5. What does the pH scale measure and why is this important?
4
Correct
Drag each label to the correct location on the image.
Name the stages of the water cycle.
condensatio
17
precipitatiom
SIT
evaporation
runoff
Free
groundwat
Next
Answer:
condensation, precipitation, infiltration, runoff, and evapotranspiration.
condensation, precipitation, infiltration, runoff, and evapotranspiration are the correct steps of water cycle.
what is condensation ?It is the process by which water vapor is converted into liquid water. It is an integral part of the water cycle.
It shows how water continually converts into three forms solid, liquid, gas throughout the earth surface.
The boiling point and the condensation point are same and take place at 100 degrees Celsius.
The temperature range of condensation occurs between 0 degree Celsius to 100 degree Celsius.
In water cycle due to condensation water molecule forms a cumulous clouds and fog followed by fall down of water droplets on the Earth’s surface as precipitation, which is commonly called rain.
Rain water enters the earth’s waterways, soil absorbed by plants or freeze into its solid form ice form.
Learn more about water cycle, here:
https://brainly.com/question/9243222
#SPJ5
6. All of the following are renewable resources except for:
A. fossil fuels
B. soil
C. water
D. forests
a - fossil fuels
step by step explanation:
fossil fuels are non-renewable and will run out
WILL GIVE BRAINLEST Why do plants store some of the food they produce?
A. to live through periods when they already have too much food
B.to have tough structures for defense
C.to provide food for other plants
D.to survive periods when they cannot make enough food
Answer:
D is your answer
Explanation:
there are times when plats cant photosynthesis to make food. So they rely on their food storage so they don't die.
I need help please ??!!!!!
Answer:
1: false
2: true
3: true
Explanation:
sorry if they wrong its on me if u use them tho
Match the materials below to the BEST option describing their place in the cycles of photosynthesis and cellular respiration.
Some options may be used more than once or not at all.
the empirical (scientific) method of study is based on ______
Answer:
Empirical research is based on observed and measured phenomena and derives knowledge from actual experience rather than from theory or belief.
Key characteristics of empirical research:
- Specific research questions to be answered
- Definition of the population, behavior, or phenomena being studied
- Description of the process used to study this population or phenomena, including selection criteria, controls, and testing instruments (such as surveys).
Which of these describes the complexity of abiotic and biotic factors within an ecosystem that supports a specific species?
A.fauna
B.biome
C.climate
D.habitat
In an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.
What is an Habitat?An habitat can be described as the sum total of resources, abiotic and biotic factors that are found in a particular environmental area which support the survival and growth of a specific species that is better adapted to it.
Examples of HabitatsWoodland Forest SeashoreGrasslandTherefore, in an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.
Learn more about habitat on:
https://brainly.com/question/931161
All sugars are considered:
a carb
a fat
just sugars
a lipid
Answer: fat......................................
I’ll give BRAINLIST??What organs/organs systems does schizophrenia affect and how does it affect it?
Answer: Schizophrenia is considered a disorder of the mind, influencing the way a person thinks, feels and behaves.
Explanation: Physical health is also important because if it is compromised, many of the benefits of improved mental health will be offset. Compared with the general population, schizophrenia patients are at increased risk of weight gain, abdominal obesity, diabetes, metabolic syndrome, and cardiovascular disease.
Answer:
Schizophrenia involves a range of problems with thinking (cognition), behavior and emotions. Signs and symptoms may vary, but usually involve delusions, hallucinations or disorganized speech, and reflect an impaired ability to function. Symptoms may include: Delusions.Schizophrenia is associated with changes in the structure and functioning of a number of key brain systems
Explanation:
Have a great day!
In cocker spaniels, solid color (S) is dominant over spotted (s). If a solid male is crossed with a spotted female and they produce all solid colored puppies, the genotypes of the parents must be:
Answer: the genotypes must be solid that is. if the male is a solid colored genotype
The triplet code of bases for RNA may be represented by all of the following except -
F CGT
G CGA
H CGG
O CGU
One important function of bones is to produce ……………….
Answer:
Red blooded cell, White blooded cell and platelets
Pls, help with science (:
what can i help u ask me if i can i will say you
What is Ecological Sustainability? What happens if we use all of our planet's resources without replacing them?
Answer:
Ecologically sustainable development is the environmental component of sustainable development. It can be achieved partially through the use of the precautionary principle. The precautionary principle (or precautionary approach) is a broad epistemological, philosophical and legal approach to innovations with potential for causing harm when extensive scientific knowledge on the matter is lacking. It emphasizes caution, pausing and review before leaping into new innovations that may prove disastrous
Explanation:
Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help