its like a twisted ladder or a double helix
how stuff works dot com
Explanation: Yes, It is like a machine only a person sits in a chair and they have to tell the truth while the worker asks the person questions and they have thing wrapped around there arm to tell if there telling the truth or lying so yes it is like a machine.
Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos
From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.
What are coral reefs?Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.
The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.
The balance in coral reefs can be disrupted by human activities such as:
Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photosHowever, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.
Learn more about coral reefs at: https://brainly.com/question/10970167
hello please help i’ll give brainliest
Answer: Clastic sedimentary rocks are made up of pieces (clasts) of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock.
Explanation:
Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *
8 amino acide are coded by _______ amino acids?
Answer:
Explanation:
nutrients i think im not sure sorry sweetheart
blue, light blue, yellow, or red
HURRY
Answer:blue
Explanation:
What is the difference between a prokaryotic cell and a eukaryotic cell?
Answer:
Size is 0.1- 5.0 um Size is 5-100 um
Nucleus is absent Nucleus is present
Membrane-bound nucleus absent. Membrane-bound Nucleus is present.
Explanation:
here are some
Answer:
One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one
Explanation:
Glad I could help! <3
what is the name of the fluid found in the gall bladder
Answer:
"Bile" is what that fluid is called
please help me with this
Answer:
prob b
Explanation:
What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio
The new cell has an increased surface area to volume ratio is a process that makes easier the exchange of materials across the surface of the cell (Option C).
What is cell division?Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.
Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.
In conclusion, news cell has an increased surface area to volume ratioand it makes easier the exchange of materials (Option C).
Learn more about the cell division here:
https://brainly.com/question/8283140
#SPJ1
.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy
Answer:
89.6Joules
Explanation:
Kinetic energy is 1/2MV^2
Where m is Mass and v is velocity.
M=81.6 v=2.2m/s
K.E= 1/2 × 81.6 × 2.2
= 81.6 ×1.1
K.E=89.6 Joules
20. What is true about the esophagus? Check all that apply.* ]
Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one
Explanation:
WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?
1. covalent because an electron is transferred from a C atom and O atom to a H atom.
2. covalent because electrons are shared between the C, H, and O atoms
3. ionic because an electron is transferred from a C atom and O atom to a H atom.
4. ionic because electrons are shared between the C, H, and O atoms
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
The atomic no. of carbon=6
Electronic configuration=2,4
The atomic no of H=1
E.C=1
The atomic no of O=8
E.C= 2,6
Therefore to attain octate state, they will share electrons
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
Took the test.
Atoms are the most basic unit of matter. Two or more atoms from the same or different elements can combine to form molecules.
Cells are the most basic unit of life. Cells are made up of many different types of molecules. Which of the following accurately shows higher levels of organization within organisms, from least complex to most complex?
A. cells → organs → organ systems → tissues → organism
B. cells → tissues → organs → organ systems → organism
C. cells → organ systems → organs → tissues → organism
D. cells → organs → tissues → organ systems → organism
Answer:
B
Explanation:
Because cells make tissues which then combine to make organs which then further combine to form system
Which makes organisms like me and you
Answer: B
(An atom is the smallest unit of matter that retains all of the chemical properties of an element. Atoms combine to form molecules, which then interact to form solids, gases, or liquids. For example, water is composed of hydrogen and oxygen atoms that have combined to form water molecules.)
Explanation : Because cells make tissues which then combine to make organs which then further combine to form system
Giving brainlist to whoever answers
Answer:
At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.
Explanation:
Answer:
heterotroph
Explanation:
PLS HELP! When I let go of a rock it falls down. What happens explain
Answer:
Gravity
Explanation:
Mark as Brainliest
what does arrows mean in science
Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
I need the answer no links and no putting random stuff I need the answer fast
Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
Explanion:
its already the answer
Who suggested that the distance of a galaxy is proportional to its recessional speed
Answer:
Edwin Hubble
Explanation:
A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?
A.
frequency
B.
wave speed
C.
period
D.
wavelength
Answerd
;-)◑__◐
Explanation:
What is likely to happen when there is more genetic diversity?
A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving
Answer:
b
Explanation:
if there is more genetic diversity then the organism will adapt much better to the environment around it
Answer:
B
Explanation:
ggggggggggggggggggggggg
DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019
Answer:
Please find the answers to the following questions below:
Explanation:
1. DNA stands for deoxyribonucleic acid
2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.
3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.
4. Three (3) letters are in the code of DNA. These three letters make up a codon.
5. Adenine - Thymine
Cytosine - Guanine
6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC
7. Proteins are a part of the structural composition of the body
Proteins serve as catalyst for biochemical reactions
Proteins are source of nutrients
8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.
9. DNA is a molecule that stores genetic information in the cell of an organism.
Name three reasons why the atmosphere is important to life on earth and explain your reasoning.
The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.
The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.
Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.
Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.
Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.
What is the "body" of a plant called?
Answer:
it's called a tissue right?
Need help ASAP! Will give brainliest;) NO links please, will report.
Which statement is part of Darwin’s theory of evolution by natural selection?
A). Acquired characteristics that are inherited are the cause of evolution.
B). The organisms that are the fittest are always largest and strongest.
C). The number of offspring is not related to fitness.
D). More offspring are produced than can possibly survive.
Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP
molten rocck near ground water supplies
A key part of the Watson-Crick model came when Watson realized
that adenine could form hydrogen bonds with thymine and guanine
could form hydrogen bonds with cytosine. This explains why A=T
and G C in Chargaff's rules. Also, these two hydrogen-bonded
nucleotide pairs had the exact same width, so they could form the
rungs of the DNA ladder.
The fact that these pairs could match up only in this way meant that
the sequence of bases in one strand could determine the sequence
of bases in a second strand created from the first. The second strand
is said to be complementary to the first strand. Individual bases are
paired so that the identity of any base determines the identity of the
base paired with it; that is, the complementary base.
This table lists the base abbreviations for bases in a sample of single-
stranded DNA. Fill in the second column with the base abbreviations
that are complementary to the given bases.
I
Answer:
A–T
T–A
T–A
C–G
A–T
G–C
G–C
C–G
T–A
A–T
Explanation:
A always pairs up with T
C always pairs up with G
A - TT - AT - AC - GA - TG - CG-CC - GT - AA - TA usually pairs up with TC usually pairs up with GThese are bases of amino acids called nucleotides sequences. And this helps in the bond of several base pairs to their nucleotide sequence.What is the Watson-Crick model?
In “A Structure of Deoxyribose Nucleic Acid,” Watson and Crick defined DNA as a double helix that contained long, helical strands wound together. In their model, every DNA strand contained personal devices referred to as bases, and the bases alongside one DNA strand matched the bases alongside the opposite DNA strand.
Thus it is clear that the above answer is well explained.
To know more about the DNA refer to the link :
https://brainly.com/question/1328358
son las fallas evidencias de la tectónica de placas de nuestro planeta Y por qué
Answer:
you're speaking in the wrong language here
Explanation:
Which animals have adapted to near-freezing water?
1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas
Answer:
whales
Explanation:
When spindle fibers do not correctly separate the chromosomes during anaphase we get a condition called _________?
A. Duplication
B. Nondisjunction
C. Translocation
Explanation:
..........................................