do anyone know
x+2=-14-x

Answers

Answer 1

Answer:

x=-8

Step-by-step explanation:

Answer 2

Answer:

x = - 8

Step-by-step explanation:

x + 2 = - 14 - x

x + x = - 14 - 2

2x = - 16

x = - 16/2


Related Questions

Evaluate {3^4}{3^2}
for brainliest plz help me

Answers

Answer:

3^4 x 3^2 = 729

Step-by-step explanation:

Answer:

[tex](3^4)*(3^2)=729[/tex]

Hope this helps.

What is the value of this expression
8 + 6x (10 - 4) +2

Answers

Answer:

[tex]8+6x(10-4)+2\\= 10 - 4\\= 6 + 2\\= 8 * (8 + 6x)\\ = 8 + 6x\\= 14x * 6\\= 84x\\[/tex]

Step-by-step explanation:

hope this helps.

I think the value of the expression is 84x

3/4c-7/12+7/24c+2/3-1/6c
simplify the expression

Answers

Answer: 7/8c + 1/12

Explanation: separate the c terms and the non-c terms. 3/4c + 7/24c - 1/6c = 7/8c

-7/12 + 2/3= 1/12

therefore, it’s 7/8c + 1/12

The simplification of the given expression (3/4)c - 7/12 + (7/24)c + 2/3 - (1/6)c is (21/12)c + 1/12.

What is an expression?

A mixture of variables, numbers, addition, subtraction, multiplication, and division are called expressions.

A statement expressing the equality of two mathematical expressions is known as an equation.

As per the given expression,

(3/4)c - 7/12 + (7/24)c + 2/3 - (1/6)c

Combined likely terms,

⇒ (3/4)c + (7/24)c - (1/6)c - 7/12 + 2/3

⇒ (3/4 + 7/24 - 1/6)c + 2/3 - 7/12

⇒ [(18 + 28 - 4)/24]c+ (8 - 7)/12

⇒ (42/24)c + 1/12

⇒ (21/12)c + 1/12

Hence "The simplification of the given is (21/12)c + 1/12".

To learn more about expression,

https://brainly.com/question/14083225

#SPJ2

What is the slope of the line represented by the points in the table?


Negative 0.05
Negative .005
0.005
0.05

Answers

Answer:

Positive 0.05

Step-by-step explanation:

[tex](-1,-.3) (1, -.2)[/tex]

[tex]m=\frac{-.2-(-.3)}{1-(-1)} =\frac{-.2+.3}{1+1} =\frac{0.1}{2} =0.05[/tex]

Hope this helps

POSITIVE 0.05

SORRY IF THIS IS NOT CORRECT

(4 x 5) ( 4 x 9)
i need help

Answers

Answer:

(20) (36) this is your answer bro

plz helppppp :)
5(x−3 3/4)=7 1/2

Answers

the answer is 10x

Solve for

x

by simplifying both sides of the equation, then isolating the variable.

x

=

10

Answer:

x = 5[tex]\frac{1}{4}[/tex]

Step-by-step explanation:

5(x - 3[tex]\frac{3}{4}[/tex] ) = 7[tex]\frac{1}{2}[/tex]

Use distributive property

5x - 18[tex]\frac{3}{4}[/tex] = 7[tex]\frac{1}{2}[/tex]

Add 18[tex]\frac{3}{4}[/tex] to both sides

5x = 26[tex]\frac{1}{4}[/tex]

Divide both sides by 5

x = 5[tex]\frac{1}{4}[/tex]

Explain, in detail, how you know if these are equivalent.

Answers

Answer:

they are equivalent.

Step-by-step explanation:

to find equivalent fractions, we need to multiply the numerator and denominator of the first fraction by the same number. this creates an equivalent fraction. 5 goes into 15 3 times, and 8 goes into 24 3 times. this shows that if we multiply both the numerator and denominator of the first fraction by 3, then we end up with the second fraction, proving that they are the same. hope this helps!

5/8. Each one you multiply by 3 is gonna be 15/24. 5 is a common factor of 15 and 8 is the common factor of 24

Who ever knows this without looking it up y'all are really smart!
Write 8/6 as a fraction with a denominator of 3.__ To solve 4/3 divided by 2/3, think,"How many two-thirds are in four-thirds"?__

Answers

Answer:

1. 4/3 and 2. 2?

Step-by-step explanation:

I have no clue tbh

EXPLAIN:    [tex]\frac{8}{6}= \frac{4.2}{3.2} =\frac{4}{3}[/tex]            [tex]\frac{4}{3}[/tex] ÷ [tex]\frac{2}{3}[/tex] = [tex]\frac{4}{3}.\frac{3}{2} =\frac{2.2}{3}.\frac{3}{2}=2[/tex]

ok done. Thank to me :>

Please answer correctly as soon as possible!! I will give you brainliest

Answers

Answer: bAKAKAKAKAKAKAKAK ✔

Step-by-step explanation:

answers: y=-3 and x=7

Find the sale price with percent markdown
A store advertises a 35% markdown on the PlayStation 5 gaming console. It normally sells for $1,019. How much would you save on the console? And what is the final sale price?

Answers

The final sales price would be 662.35. And you would save 356.65

There are 32 more pupils in the Robotics Club than in the Art Club. The number of pupils in the Robotics Club is 18 less than 3 times the number of pupils in the Art Club. How many pupils are there in the Robotics Club?

Answers

78 pupils,
32r =18
R=3a-18
R= 3(32)-18
R=96-18

Tyler bought 14 tickets to a basketball game. The group rate saved him $5.25 per ticket. He paid a total of $283.50 for the tickets.

What was the regular price of a ticket to the game?

Enter your answer in the box

Answers

25.5

Step-by plantation:

283.50 divide by 14 = 20.25

then take 20.25 and add 5.25 = 25.5

multiply by 14 = 357 total without discount

7 increased by a number w

An expression is

Answers

an expression for this would be, w + 7
w+7 because it’s increasing w

Help ..
Sandy works at a clothing store. She makes $8 per hour plus earns 10% commission on her sales. She worked 70 hours over the last two weeks and had a total of $1,612 in sales before taxes.

Which of the following is closest to how much she will earn in hourly wages and commission for those two weeks?
A.
$721
B.
$560
C.
$161
D.
$217

Answers

Answer:

A

Step-by-step explanation:

First, I'm going to work out the hourly wages for the 2 weeks.

$8 x 70hours = $560

(8 x 7 = 56 x 10 = 560)

Next, work out the commision.

10% of $1612

1612 ÷ 10 = 161.2

Finally, add together both the hourly wages and commision.

161.2 + 560 = 721.2

Round it down to a whole number.

721 , Add on the dollar sign.

It's answer A, $721.

A. 721
I’m pretty sure it’s 721$

The question is attached.

Answers

i don't think that's possible bro. you gotta tell ur teacher that. if ur teacher says it is possible , try the app Socratic. that might help

Pls help with at least one and explain how u solved it so I can do the rest myself

Answers

Answer:

14. decrease

15. divide 59.95 by 40

16. increase

HELP, BRAINLIEST IF CORRECT Two teams working together can finish a job in 8 days. if the first team works alone for two days and the second team works alone for 5 days, 5/8 of the total work still remains. How many days will it take each team to finish the work alone?

Answers

Answer:

If 2 teams work together they can finish a job in 8 days. The rate of work of the first team is 5/8 of the rate of the second team. How many days each team needs to complete this job working alone.

Step-by-step explanation:

I think it would be 7 days but I’m not to sure

WILL MARK BRAINLIEST!!!!!!!

There are 32 more pupils in the Robotics Club than in the Art Club. The number of pupils in the Robotics Club is 18 less than 3 times the number of pupils in the Art Club. How many pupils are there in the Robotics Club?

Answers

Answer:5. There are 32 more pupils in the Robotics Club than in the Art club.

Step-by-step explanation:

Answer:what

Step-by-step explanation::>

Mr. Quick bought a new computer system. The regular price was $1,580, but he got a 15% discount. How much did he actually pay?

Answers

Answer:

$1343

Step-by-step explanation:

Mr. Quick bought a new computer system. The regular price was $1,580, but he got a 15% discount. How much did he actually pay?

You need to turn 15% into a decimal.

Move the decimal point to the left 2 spaces.

15 ---> 1.5 ---> 0.15

Now multiply 0.15 by $1,580.

0.15 × $1,580

Which is $237.

Now subtract $1580 - $237.

Which is $1343.

Answer:

$1580*15/100=$237that is discount rate.

$1580-237=$1343 actually pay

Find the total cost with sale tax.
Show all your steps ( Works)
Holly has $15 to buy a gift for her brother. She found a stuffed animal that cost $12.50. With 10.1% sales tax added on, what is the sale tax? What is the total cost of the stuffed animal with tax included?

Answers

ANSWER: $13.76

Explanation:

We know the stuffed animal cost $12.50 and we know the sales tax is 10.1%. So we need to find 10.1% of 12.50. In math of means multiplication so it’s

10.1 x 12.50

Multiply like normal to get 1.2625

I’m assuming you round and get 1.26.

Now we know the sales tax and the price of the stuffed animal. But to know what it is after the sales tax we need to add.

1.26 + 12.50 = $13.76
The Answer is $13.76

Alan wears his coat when the temp is colder than -4.c
write an inequality that i true only for temps(t) at witch Alan wears his winter coat

Answers

Answer:

T<-4.c

Step-by-step explanation:

If it’s “less than” then the stated number is the highest number that you can have

- 1/9x+2.4=6 what is x

Answers

First we’re going to subtract 2.4 from both sides
-1/9x+2.4-2.4=6-2.4
Then we’re going to simplify
-1/9x=3.6
Then multiply both sides by -9
(-1/9x) (-9) =3.6 (-9)
Then you just Gotta simplify
U get
X=-32.4
It makes it easier by converting the expression on the left of the equal sign to fractions( 2.4 to 12/5) Answer: X=-32.4

You buy 3.18 pounds of apples, 1.25 pounds of pears, and 2.67 pounds of oranges. What is your total bill rounded to the nearest cent?

Answers

Answer:

318125267

Step-by-step explanation:

-_-...............that is the answer

3.17 pounds of apples

   1.25 pounds of pears2

   2.56 pounds of oranges

add = 7.98

rounded = 7.42, (or anything close. I am really bad at rounding decimals)

Bots have answered this for the past two times but I still need help. The question is below.

Answers

Answer:

a. False

b. True

c. True

d. I think it's true

e. False

Step-by-step explanation:

a. The unit rate is 19.75 gallons per minute

b. It is true because when x=0 y is also equal to 0, therefore it passes through the origin

c. 19.75 is about 20, and 20 multiplied by 5 is 100

d. Like I said before I don't know but I hope you get it correct ._.

e. When x=8 the equation would be 19.75*8 which is equal to 158 not 150

False
True
true
true
False

You have the cards numbered 1-10 in front of you.Each time you select a card,it is returned.What is the probability of selecting a 3 and then an even number

Answers

Answer:

[tex]Both \: the \: moon \: and \: earth \: are \: in \: \\ the \: shape \: of \: spheres. \\ Surface\: area \: of \: a \: sphere \: of \: radius \: 'r' \\ [/tex]

Let d1 be the diameter of the moon and d2 and be the diameter of the earth.Let r1 be the radius of the moon and r2 be the radius of the earth.

[tex]given \: d1 = \frac{1}{4}d2 \\ = > 2r1 = \frac{1}{4} ×2r2 \\ =>r1 = \frac{1}{4}×r2 \\ Now, \: ratio \: of \: \: their \: surface \: areas \: is: \\ = s1: s2 \\ = r {1}^{2}: r {2}^{2} \\ = {1}^{2 } : {4}^{2 } \\ =1:16[/tex]

hope it helps you

Terry's father is 76 inches tall. Terry's height is 75% of that height of his father. How tall is Terry?

Answers

Terry would be 57 inches tall because 75% of 76 is 57.

Answer: Terry is 57 inches tall

Step-by-step explanation:

First, find the percentage . . . what is 75% of 76 ? 57

I dont get this can someone please help me.

Answers

Answer:

x[tex]\geq 10[/tex]

Step-by-step explanation:

[tex]5+ \frac{x}{2} = 10\\10+x=20\\x=20-10\\x=10[/tex]

11.50 + 1.15x = 12.65
11.50 - 11.50 + 1.15x = 12.65 - 11.50

➗ 1.15x = 1.15 ➗ what does x equal? Please explain in great detail how you figured this out also replace the = with the proper inequality sign and explain how you did that as well.

Answers

Answer: the answer is x= 1

Step-by-step explanation:

So we are dealing with 11.50 - 11.50 + 1.15x = 12.65 - 11.50

our first step is Simplify both sides of the equation so:

11.5 + -11.50 + 1.15x = 12.65 + -11.50 turns into:

(1.15x) + (11.5+ -11.5)= (12.65 + -11.5)

**we know 11.5 + -11.5 will cancel each other since they are opposite**

so it will be 1.15x= 1.15

now the very last step is to divide 1.15x on both sides which gives us 1

X=1 I hope it helps but I’m sorry if it’s wrong

when keisha installed a fence along the 200 feet perimeter of her rectangular back yard she left and opening for GATE in diagram below she used X to represent the length of the gate (I give brainliest)

Answers

Answer:

(x + 60 + 30) * 2 = 200

(x + 90) * 2 = 200 multiply 2 inside parentheses

2x + 180 = 200 move 180 to the other side with changing it's sign

2x = 20 multiply by 2

x = 10 here is the answer

Step-by-step explanation:

Perimeter = (length + width) * 2

Hope this helps.

Answer it will help u sure

PLEASE HELP ASAP!! ILL GIVE BRAINLIEST IF CORRECT

Two linear functions are represented in different formats.


Function 1:

x y

0 5

2 ​11​

5 ​20​

8 ​29​

Function 2: (image below)


Which statements are true?

Select each correct answer.


Function 1 has a greater rate of change than function 2.


Function 2 has a greater rate of change than function 1.


Function 1 has a greater y-intercept than function 2.


Function 2 has a greater y-intercept than function 1.

Answers

Answer:

Function 1 has a greater Y intercept than that of function 2

Step-by-step explanation:

Y intercept can be found by replacing x by 0 or

x = 0 0f the given function.

in this case Function 1 has a Y intercept of 5 when x =0

on the other hand, function 2 crosses the y axis once at -1 which is the y intercept.

you can now clearly see that

y = 5 > y = -1

---> 5>-1

so that's why we conclude that 1 has a greater Y intercept.

Other Questions
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ a uniform thin rod of length l and mass m is allowed to rotate on a frictionless pin passing through one end. The rod is released from rest in the horizontal position. a.) What is the speed of the center of gravity when the rod reaches its lowest position? b.) What is the tangential speed of the lowest point of the rod when the rod reaches its lowest position? Which examples of propaganda are found in this passage? Select two options.Snowball is used as a scapegoat.Napoleon talks to the animals through Squealer.Squealer targets his message to emphasize plain folks.Squealer uses glittering generalities to describe Napoleons tactics.Napoleon uses name-calling to differentiate the pigs from the other animals. who were dev and ashamvav At a hospital, 56 percent of the babies born are not girls. Of the baby girls born, 12 percent are premature. What is the probability of a premature baby girl being born at this hospital? round to the nearest percent. Why did Marshall describe the economy in Europe over the past 10 years as "highlyabnormal"? which organelle modifies sorts and packages proteins I need some essay ideas for: "Describe the biggest challenge youve faced and overcome as a student OR Describe a time when you failed and persevered through the situation?"What can I write about? DNA contains all the traits that we inherit from our parents.True or false Pls explain how to solve it! (Will mark brainylist)