Create a Punnett square showing a cross between the two F1 parent plants. Their offspring are the F2 generation.

Answers

Answer 1

Here is the answer to the question

Create A Punnett Square Showing A Cross Between The Two F1 Parent Plants. Their Offspring Are The F2

Related Questions

why are peas carbohydrates

Answers

Complex carbohydrates are made up of sugar molecules that are strung together in long, complex chains. Complex carbohydrates are found in foods such as peas, beans, whole grains, and vegetables. Both simple and complex carbohydrates are turned to glucose (blood sugar) in the body and are used as energy.

Explanation:

Hope this helps you !!

Earthquake and faults

Answers

Answer:

Hey mate.....

Explanation:

This is ur answer.....

Earthquakes occur on faults. A fault is a thin zone of crushed rock separating blocks of the earth's crust. When an earthquake occurs on one of these faults, the rock on one side of the fault slips with respect to the other. The fault surface can be vertical, horizontal, or at some angle to the surface of the earth.

Hope it helps!

Brainliest pls!

Follow me! :)

chains of amino acids make ____ which can fold to make a ____
PLEASE HELO BEFORE MY 6th HOUR!!!

Answers

Answer:

Chains of amino acids make Proteins which fold to make a complex three dimensional shape.

15. Which of the following is controlled by multiple genes and influenced by the environment? *
Codominant traits
Single gene traits
Polygenic traits
Incomplete dominant traits

Answers

Polygenic traits-more than one gene controls the trait, like height or skin color

What is the genetic information that must be copied for the next generation of cells called?

A. Gametes
B. DNA
C. Meiosis
D. Mitosis

Answers

Answer:

B. DNA

Explanation:

DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms. Nearly every cell in a person's body has the same DNA. The information in DNA is stored as a code made up of four chemical bases: adenine, guanine, cytosine, and thymine.

Which of the following is a biotic factor in an ecosystem?
a. Tree leaves
b. Wind
c. Small rocks
d. Light from the sun

Answers

Answer:

tree leaves

Explanation:

In chemiosmosis what is the most direct source of energy?

Answers

Answer:

In chemiosmosis, the most direct source of energy used to convert adp+pi to atp is through oxidative phosphorylation by energy released from movement of protons through atp synthase, down their concentration gradient.

Hope this help you! :)

write the main roles of water

Answers

Answer:

Keeps people's health in order by carrying nutrients and oxygen to cells, Protects humans organs and tissues and Helps to regulate temperature and help the body in many ways. Also, up to 60% of the human body is water.

Hope that helps. x

How do scientists identify organisms that may have disease resistance genes?

Answers

Answer:

The use of genetic engineering in developing disease-resistant plants. The techniques of genetic engineering can be used to manipulate the genetic material of a cell in order to produce a new characteristic in an organism.

2
1 point
Which DNA strand below represents the complementary base sequence of a DNA strand represented by the sequence: 5-ATCGTA-3'
3-CATGAC-5
3-TAGCAT-5
ОООО
3-ATGCTA-5
3-GCATCG-5
ery

Answers

Answer:

WHY SO SERIOUS?

Explanation:

HAHAAHAHHAH

The ____________ is a muscular dome that forms the inferior boundary of the thorax, separating the thorax from the abdomen.

Answers

Answer: the answer is diaphragm

Why does the stick immersed into water look bent? Explain with the ray diagram

Answers

Answer:

dhdhudhsusgiagwiwhw

Explanation:

Enter the following transactions into richard’s checkbook register and state his ending balance: date type description amount 03/01 check #204 blue sky apartments $455. 00 03/05 dep payroll automatic deposit $390. 36 03/08 debit benny’s hamburgers and fries $9. 20 03/15 check #205 car payment $251. 59 03/19 dep payroll automatic deposit $390. 36 a. $715. 79 b. $1,009. 81 c. $780. 72 d. $880. 24.

how long does better than bouillon last after opening

Answers

Since the ingredients include ground meat and vegetables, Better than Bouillon must be stored in the refrigerator. But don't worry that it will go bad quickly — it has about an 18-month shelf life from the time it's opened.

Which of the following relationships may present harm to one of the organisms involved? I. Commensalism II. Parasitism III. Predation IV. Mutualism *

Answers

Answer:

lll. Predation

I think this is right

Write about Cryptogams and Phanerogams

Answers

Explanation:

Cryptogams: Thallophytes, Bryophytes and Pteridophytes are called Cryptogams.Cryptogamae means having hidden reproductive organs.The reproductive organs in these plants are inconspicuous. Their naked embryos are called spores.Phanerogams: Gymnosperms and Angiosperms are Phanerogams.Phanerogams are the plants with well differentiated reproductive tissues. The seeds enclose embryo which is suspended in the stored food.

-TheUnknownScientist 72

Read this paragraph from "How Water Loss Affects Biodiversity."
“When a region experiences a significant drought, many animals may die from lack of water and food. […] If tourism declines due to high wildlife casualties, then the locals who depend on income from tourism will lose their livelihood. People may then turn to farming to earn money, but crops require water to grow. This can place further strain on the water supply and worsen the original problem of the drought.”

What event can cause many animals to die from lack of water and food?

Answers

Answer:

Eggs and fried chicken with mentally stabled fries

proteins are responsibe for

A.) insulating the body
B.) Maintaining the structure of cells and tissue
C.) Storing energy from unused glucose molecules
D.) Holding the blueprints that code for all the cell's activities

Answers

Answer:

Explanation:

Answer:

its a.

Explanation:

im learned protiens in biology like 4 weeks ago.

Can someone plz help me?

Answers

Answer:

Mitochondria

Explanation:

hope it helps

A constant rate of increase for a population produces a growth graph that is J shaped rather than a straight line. Why?

Answers

Because it represents the population density is increasing, an organism increases rapidly in an exponential (logarithmic) form

HELPPP
Which of these is not associated with expiration?
A. high pressure

B. relaxed diaphragm

C. increased volume

both B and C answers

Answers

Answer:

(A)

Explanation:

High pressure has nothing to do with expiration(breathing out).

Hope it helps :)

The diagram shows structures that form the surface of the trachea.
Which level of organisation is the structure labelled S?
A. Cell
B. Organ C. Organ system
D. Tissue

Answers

A

Cell which is the structure that form surface of trachea

Answer:

which diagram

Explanation:

A form of asexual reproduction in bacteria and other prokaryotes that involves the splitting of a parent cell into two independent cells is
called binary fission

True
False

Answers

i think the answer is true but im not for sure

Which one of the following disease is caused by a protozoa?
a.Kala-azar
b.Sleeping sickness
c.Rabies
d. both a and b

Answers

Answer:

D: Both A and B.

what are the primary consumers in the Arctic food web?

Answers

Answer:

Humans (notice how many arrows go towards the humans, and how there are no predators of humans).

Explanation:

Humans, polar bears, and killer whales

My cells have an organized nucleus. am usually made of many cells, but sometimes I can be single celled. I cannot make my own food, sol must eat. I can have one or two parents. Guess Who?

Answers

Answer:

Animalia

Explanation:

which mutations are beneficial? which might not make a difference? which ones are most harmful?

Answers

Answer:

Mutations are random Mutations can be beneficial, neutral, or harmful for the organism, but mutations do not “try” to supply what the organism “needs.”

Explanation:

A baby carriage is sitting at the top of a 21 m high hill. It weighs 12 N. It has ________________ energy?

A - kinetic
B - Potential

Answers

Answer:

B- Potential

Explanation:

The object has the potential energy to be converted to kinetic energy if it starts to roll down the hill. But right now it has the potential for energy.

Most of the energy from respiration is released in the _______.

Answers

Answer:

Mitochondria?

Sorry if it's incorrect. x

Is released in the Mitochondria

which type of stem cell gives rise to red and white blood cells?

Answers

Answer:

hematopoietic stem cells

Explanation:

3. Name the division of the peripheral nervous system that is activated in each of these
examples:

a. You are startled when a friend pulls a practical joke and spooks you with a loud sound.

b. You move your arms and legs to take an evening walk.

c. Your stomach makes a gurgling sound as it digests your lunch.

d. Feeling a little stressed? You take a few breaths to calm down.

e. You are at the line, waiting for you race to start, and your heart begins to pound.

Answers

A startle reflex (a), digestion (c), breathing (d) and heart pumping (e) are responses of the ANS, while arm/leg movement (b) is a response of the SNS. They are major divisions of the PNS.

The peripheral nervous system (PNS) serves to connect the central nervous system to different organs, limbs, and skin.

The PNS can be divided into Somatic Nervous System (SNS) and Autonomic Nervous System (ANS).

The Somatic Nervous System is responsible for controlling the voluntary movements of the body.

The Somatic Nervous System is responsible for regulating the involuntary movements (reflexes) of the body.

Learn more about the peripheral nervous system here:

https://brainly.com/question/328696

Other Questions

Q). A man x. He gave half of it to his wife, 1/4th to his son and 1200 of his daughter. Form an equation and also find x. Which sentence would improve this conclusion? every town should consider adding bicycle lanes, because it is a great idea. Organizing safety classes for drivers and cyclists will ensure that everyone knows the rules. Do not listen to negative people who complain about anything new. It is true that some people might get injured, but even walking can be dangerous. 1. What is a myth?a) A true story of gods from long agob) A story that often tells a lesson and explains the creation of somethingc) A fictional story based on real people from history.d) A story with taking animals that tells a lesson. PLEASE HELPP!!!! Which process does osmosis involve?A. movement of solute up a concentration gradientB.movement of solute across the cell membraneC. movement of water across a cell membraneD. movement of water up a concentration gradient Observe the cell as it moves from stage to stage through cell division. What trends can you describe about the cell and its internal contents? Question 8 of 10The molecules that make up food contain energy. How does the human bodyget energy from the food molecules?A. By adding energy to the moleculesB. By breaking and reforming chemical bonds in the moleculesC. By using them to form ionic bondsD. By combining the molecules together A garden hose shoots water horizontally from the top of a tall building toward the wall of a second building 20 meters away. If the speed with which the water leaves the hose is 5 m/sec, how long does it take the water to reach the second building, and what distance does the water fall in this time? Understand how to work with negative bases and negative exponents.5^2 = 5^-2 = (-5)^2 = - 5^2 = (Remember to find the base, then multiply.) Does anyone know the answer for this question? I really need it. ______ is an example of a TCS food.A whole watermelonChickenBreadUncooked (dry) rice A piecewise function is represented by the graph below.On a coordinate plane, a piecewise function has 2 lines. The first line is made up of 2 lines. One line goes from (negative 5, 3) to (negative 1, negative 1) and then goes up to a closed circle at (1, 1). The second line has an open circle at (1, 2) and then continues up through (3, 4).What is the domain for the piece of the function represented by f(x) = x + 1?x < 11 x 11 x < 2x > 1 Termina cada conversacin para indicar que la segunda persona est de acuerdo con la primera. 8. Carolina: A m no me gusta limpiar (to clean) la casa. Miguel: A m ____________________________. Immersive Reader(1 Point)tambientampoco Exam GuidelinesExam InstructionsQuestion 4 of 20:Select the best answer for the question.4. Which of the following statements about writing introductions and conclusions is true?O A. Always write the body paragraphs and the conclusion before going back to write the introduction.B. If you have trouble beginning with the introduction, write the body paragraphs first.C. If you're writing a research paper, you don't need an introduction or a conclusion.D. Always write the introduction first and the conclusion last.Mark for review (Will be highlighted on the review page)> Is this statement true or false?Impressionist paintings by John Twachtman depict a moment in time.truefalse What happend when matter condenses??Plzz Answer??? Is this table proportional?XY1 3 34 125 157 21 Your engineering department is asked to evaluate the performance of a new 370-hp sports car. You know that 27% of the engine's power can be converted to mechanical energy of the 1200-kg car, and that the power delivered is independent of the car's velocity. What do you report for the time it will take to accelerate from rest to 60 mi/h on a level road? A geriatric team wants to involve the patients family in his or her care. When is the best time to invite the family to become part of the team?not at allbefore the patients procedureafter the patients dischargeat the very beginning 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Which one is correct