Can someone please help me, i don't understand this work.

Can Someone Please Help Me, I Don't Understand This Work.
Can Someone Please Help Me, I Don't Understand This Work.

Answers

Answer 1

Answer: Check out the diagram below for the filled out table

Equation is y = 1.5x

Box for row one = 330

Box for row two = 1000

Box for row three = 1.5

===========================================================

Explanation

x = amount of fish in grams (horizontal axis)y = number of calories (vertical axis)

The point (x,y) = (200,300) is on the blue diagonal line. It indicates that x = 200 grams of fish have y = 300 calories. Divide the two values to get the slope

slope = y/x = 300/200 = 1.5

This trick only works because the line is going through the origin. Otherwise, we'd have to use the slope formula.

The slope of 1.5 is the constant of proportionality. It tells us the equation is y = 1.5x. Whatever x is, multiply by 1.5 to get y.

So if x = 220, then y = 1.5x = 1.5*220 = 330

220 grams of fish have 330 calories. We'll write 330 in the box of the first row of the table.

-----------------

We can use this idea in reverse. If we know the calorie count (y), then we can divide by 1.5 to get the number of grams (x).

y = 1.5x

1500 = 1.5x

1.5x = 1500

x = 1500/(1.5)

x = 1000

Therefore, 1000 grams of fish have 1500 calories. We'll write 1000 in the box of the second row.

------------------

The third row of the table is going to follow the same steps as the first row.

y = 1.5x

y = 1.5*1

y = 1.5

One gram of fish produces 1.5 calories

The filled out table is shown below. I've merged the two screenshots you posted into one image, and filled out the boxes.

Can Someone Please Help Me, I Don't Understand This Work.

Related Questions

winter coat was originally priced at 140$ and went on sale for 91$ by what percentage was the price of the winter coat reduced?

Answers

Answer:

35%

Step-by-step explanation:

Find out what percent 91 is of 140

91÷140 = 0.65

Then find out how much was reduced by subracting 0.65 from 1

1 - 0.65 =0.35

The coat was reduced by 35%

1+1=3 proof
needs step by step explanation

Answers

Answer:

1+1=3, See explenation

Step-by-step explanation:

1+1=2 but thats basically 2.1 because whole numbers are boring, but 2.1 is basically 2.2 because we want it as an even number, but 2.2 is basically 2.3 because 2.3 is the luckiest number, which is basically 2.5 if you think about it because 2.3 looks like 2/3 and two thirds can't be a whole (which is why we say 3/3 instead of 2/3) and 2.5 rounded up is 3. So thats how 1+1=3

e. Find the slope of the line that passes through the points (1, 3) and (9,7),

Answers

Answer:

0.5

Step-by-step explanation:

→ Find the difference in y

7 - 3 = 4

→ Find the difference in x

9 - 1 = 8

→ Divide the results

4 ÷ 8 = 0.5

Answer:

The slope is 1/2 (m=1/2)

Step-by-step explanation:

Use the slope formula: [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex] to solve for the slope. y2 is 7, y1 is 3, x2 is 1, x1 is 9. [tex]\frac{7-3}{9-1}=\frac{4}{8} = \frac{1}{2}[/tex]

Find an equation of a degree 3 polynomial (in factored form) with the given zeros of f(x): -5, -3,1.
Assume the leading coefficient is 1.

Answers

Answer:

f(x) = x^3 + 7x^2 + 7x -15

Step-by-step explanation:

f(x) = (x+5)(x+3)(x-1)

f(x) = (x^2 + 3x + 5x + 15)(x-1)

f(x) = (x^2 + 8x + 15)(x-1)

f(x) = x^3 + 8x^2 + 15x -x^2 -8x -15

simplify

f(x) = x^3 + 7x^2 + 7x -15

Answer:

[tex]f(x) = (x + 5)\, (x + 3)\, (x - 1)[/tex].

Step-by-step explanation:

By the factor theorem, if a constant [tex]a[/tex] is zero of the polynomial [tex]f(x)[/tex], [tex](x - a)[/tex] would be a factor of this polynomial. (Notice how [tex]x = a[/tex] would indeed set the value of [tex](x - a)\![/tex] to [tex]0[/tex].)

For instance, since [tex](-5)[/tex] is a zero of the polynomial [tex]f(x)[/tex], [tex](x - (-5))[/tex] would be a factor of [tex]f(x)\![/tex]. Simplify this expression to get [tex](x + 5)[/tex].

Likewise, the zero [tex](-3)[/tex] would correspond to the factor [tex](x + 3)[/tex], while the zero [tex]1[/tex] would correspond to the factor [tex](x - 1)[/tex].

All three of these factors above are linear, and the degree of the variable [tex]x[/tex] in each factor is [tex]1[/tex]. Multiplying three such linear factors would give a polynomial of degree [tex]3[/tex].

Given the three factors, the expression of [tex]f(x)[/tex] in factored form would be:

[tex]f(x) = m\, (x + 5)\, (x + 3)\, (x - 1)[/tex] for some constant [tex]m[/tex].

When this expression is expanded, the constant [tex]m[/tex] would be the coefficient of the [tex]x^{3}[/tex] term (the leading term.) In other words, [tex]m\![/tex] is the leading coefficient of [tex]f(x)[/tex]. This question has required this coefficient to be [tex]1[/tex]. Thus, [tex]m = 1[/tex]. The expression of [tex]f(x)\![/tex] in factored form would be:

[tex]f(x) = (x + 5)\, (x + 3)\, (x - 1)[/tex].

How do you factor x³-9?

Answers

Answer:

(x² + 3)(x-3)

Step-by-step explanation:

Since the exponent is uneven you can take 2 and 1 and add them to the x's multiply to get 3 and since 9 is a perfect square you can square root it and get 3 which you put on both sides. Since the 9 is negative one of the symbols have to be negative, usually put in the second parenthesis.

Hope this helps!

Remember SOAP. Same, opposite, always positive.
(X-3)(x^2+3x+9)
The formula is (a+b)(a^2+ab+b^2) but the pluses and minuses follow SOAP

1
x 1.0 -
=
10
1
-
10 x 1.0

Answers

Step-by-step explanation:

the question doesn't make sense and you need to rephrase the question.

What is a2-b2 equal to?​

Answers

aZ+b?=is equal to
Step-by-step explanation:
One Solution.
a? + b2= c2, is called the Pythagorean Theorem.
For example
42+32=62
16+9= c2
25=62
Second solution: Formula of algebra
a2+62
Cause,
(a+b)2= a?+ b2 + 2ab
So, a?+ b2= (a+b)2-2ab

There are 40 slices of pizza at the party that are shared equally between 8 people. Peter ate 3 slices of pizza before he came to the party. How many slices of pizza did Peter eat in all?

Answers

Answer:

that depends if it's taken in consideration the pizzas that he ate were from the 40 slices or not

Answer:

he ate 5 slices

Step-by-step explanation:

40/8=5 you would thinks you are timeing the answer

I didn't pay attention today​

Answers

Answer:

because you was busy and nor interested in paying attention.

When the greatest common divisor and least common multiple of two integers are multiplied, their product is 200. How many different values could be the greatest common divisor of the two integers

Answers

Answer:

k = 1 or 2 or 5 or 10

Step-by-step explanation:

Suppose GCD is k, 2 numbers are kA and kB

LCM is k*A*B,

GCD*LCM: k*(k*A*B) = 200

k² * A*B = 200

A*B could be 1 , 2, 4, 5, 8, 10, 20, 25, 40, 50, 100, 200

k² (k is integer) could be 1, 4, 25, 100

k = 1 or 2 or 5 or 10

Find a degree 3 polynomial with real coefficients having zeros 4 and 4i and a lead coefficient of 1. Write P
in expanded form. Be sure to write the full equation, including P(x) = .

Answers

Answer:

P(x)= x^3 - 4x^2 + 16x - 64

Step-by-step explanation:

First, let’s find all of the zeroes. If the question is asking for a degree 3 polynomial, than there has to be more than 2 zeroes. The complex conjugates theorem states that if a+bi is a zero, than a-bi has to be a zero as well. So if 4i is a zero, than -4i has to be a zero as well. By looking at the zeroes, you can write them as a linear factorization.

(x-4)(x+4i)(x-4i)

If you foil all of it, you will get x^3 - 4x^2 + 16x - 64.

what would be the resulting difference if the line transition: width 2s, height 2s; was removed from the first css rule?

Answers

Answer:

ages would no longer get larger as the mouse hovers over them. The transition would happen over 10s, since this is the default duration.

Step-by-step explanation:

You went 160 miles in 20 hours. What is the constant of proportionality that relates the y, the distance in miles to x, the time in hours?

Answers

Answer:

X = Y times 8

Step-by-step explanation:

You need to figure out how many miles you can go in an hour.

160/x and 20/1

20x=160

x=8

You can go 8 miles in 1 hour.

Therefore, if X is 1 and Y is 1

1 = 8

1 hour equals 8 miles

The long sides of a rectangle measure 5 ft 6 in, and the short sides are 3 ft 4 in. What is the perimeter?

Answers

Answer:

17 ft 8 in

Step-by-step explanation:

Write the inequality represented by the graph below.

Answers

Answer:

y > -x + 3

Step-by-step explanation:

find the slope and y-intercept so you can create a linear equation:

y = mx + b ;   m = slope and  b = y-intercept

slope (m) = (3-0) / (0-3)

m = 3/-3 or -1

we can see the y-intercept by looking at the graph, it is 3

y > -x + 3

1000000x900=?????????????

Answers

Answer:

The answer is 900000000

Answer:

900000000, or 9.0x 10^8

Step-by-step explanation:

do 1(9)=9

then add the 0's behind.

Determine whether the following sequence is arithmetic,
geometric, or neither.
1. 4, 1, 2
2. 4, 20, 100
3.212 106,53

Answers

Answers:NeitherGeometricGeometric

=================================================

Explanation:

The sequence {4,1,2} is neither because both arithmetic sequences and geometric sequence are either always increasing or always decreasing. We start off decreasing when going from 4 to 1, but increase to 2.

----------

The sequence {4,20,100} is geometric because we multiply each term by 5 to get the next term. That means the common ratio is 5. Notice how this sequence is increasing.

---------

The sequence {212,106,53} is also geometric. This time the common ratio is 1/2 = 0.5; this sequence is decreasing.

Line N passes through the points (-1, 4) and (-1, -4).
5
4
3-
2
1
-5 -4 -3 -2 -14
1
2 3 4 5
x
X
اسة.
5
3
ܛܝܝܝ
5
Which is true of line N?

Answers

Answer:

i don't know btw is this eighth grade

PLEASE HELP!! find the value of x. attached image.

Answers

Answer:

x = 4

Step-by-step explanation:

    The angle markings at the bottom of the triangle mean they are congruent. Since they are the only two congruent to each other, that means this triangle is an isosceles triangle.

    In an isosceles triangle, not only are the bottom angles congruent, their opposing sides are congruent as well. In this instance, that means 9x - 8 = 28. Knowing that we can solve for x.

[tex]9x-8=28\\\\9x-8+8=28+8\\\\9x=36\\\\\frac{9x}{9}=\frac{36}{9}\\\\x=4[/tex]

Answer:

x = 4

Step-by-step explanation:

9x - 8 = 28 ( converse of isosceles triangle )

(If two angles of a triangle are congruent , then the sides opposite to these angles are congruent.)

[tex]9x - 8 = 28 \\ 9x - 8 = 28 + 8 \\ 9x = 36 \\ \frac{9x}{9} = \frac{36}{9} \\ x = 4 \\ [/tex]

What is the distance between (7, 1) and (-4, -5)?

Answers

Answer:

The distance between [tex](7,1)[/tex] and [tex](-4,-5)[/tex] is [tex]\sqrt{157}[/tex] units

Step-by-step explanation:

Use the distance formula [tex]d=\sqrt{(y_2-y_1)^2+(x_2-x_1)^2}[/tex] where [tex]d[/tex] is the positive distance between [tex](x_1,y_1)[/tex] and [tex](x_2,y_2)[/tex]:

[tex]d=\sqrt{(y_2-y_1)^2+(x_2-x_1)^2}[/tex]

[tex]d=\sqrt{(-5-1)^2+(-4-7)^2}[/tex]

[tex]d=\sqrt{(-6)^2+(-11)^2}[/tex]

[tex]d=\sqrt{36+121}[/tex]

[tex]d=\sqrt{157}[/tex]

Therefore, the distance between [tex](7,1)[/tex] and [tex](-4,-5)[/tex] is [tex]\sqrt{157}[/tex] units

Answer: The distance between (7,1), and (-4, -5) is 12.53.

Replace the power with a product and then transform the product into a polynomial. (1-y)^2

Answers

Answer:

 1-2y+y^2

Step-by-step explanation:

(1–y)^2

(1-y) * (1-y)

FOIL

first: 1*1 =1

outer: 1*-y = -y

inner: -y *1 = -y

last: -y*-y = y^2

Add together: 1+-y-y+y^2  

Final answer1-2y+y^2

Credit:

wegnerkolmp2741o

He solved it earlier.

Evaluate the expression when c=−4 and y=2
-y+4c

Answers

Answer:

-2 - 16 = -18

Step-by-step explanation:

-y+4c

You take the values for c and y and substitute them in the original equation.

It would then look like:

-(2) + 4(-4)

Solving that would be -2 -16 = -18

Answer:

-18

Step-by-step explanation:

-(2)+4(-4)    Plug in the values of y and c.

-2+(-16)       Simplify.

-2-16

-18

Hope this helps you out!! Have an amazing day <3

I NEED HELPP WITH THIS

Answers

Answer:

Look at the screenshots

Step-by-step explanation:

When we first learn arithmetic, we focus on working with whole numbers. Then, we extend our understanding to fractions and negative numbers.

In algebra, we transfer these same skills to expressions involving variables. What elementary skills have you used so far in this course, and how have you extended them?

PLESE ANSWER AS FAST AS YOU CAN, IT MEANS ALOT!

Answers

Answer:

I don't think I can remember every skill I was taught through the years but in Kindergarten we used Number Sense so we could understand the meaning of more and less also there's estimation and  PEMDAS. I've also learned how to round up so that the solution is at least around those numbers if the skill is to be applied.

hope that helps

Step-by-step explanation:

Solve for x
-7x - 8 = 10x +4

Answers

Answer: put 14

Step-by-step explanation:

-0.5x=3.6

F. -72
G. -7.2
H. 7.2
I. 72

Answers

Answer:

G

Step-by-step explanation:

3.6÷-0.5 is -7.2, so it's G

Which equation could have been used to create this table? need answer fast


y = x + 6


y = x + 5


y = 6x

y = 7x

Answers

Answer:

y=6x

Step-by-step explanation:

Each value for y is can be divided by 6 for the value of x

Answer:

y=6x

Step-by-step explanation:

Which of the following are involved in graphs of linear equations.

* Intercepts

* The graph is a curve

* The graph is the solution set.

* Slope

* The equation usually has a squared variable

Answers

Answer:

Step-by-step explanation:

* Intercepts  YES  The point where the line crosses the y axis (the value of y when x=0)

* The graph is a curve No.  It would not be a linear equation.

* The graph is the solution set. Yes.

* Slope  Yes

* The equation usually has a squared variable No

Need help quickly please

Answers

Step-by-step explanation:

just want your ponit hahahaHA

The FitnessGram™ Pacer Test is a multistage aerobic capacity test that progressively gets more difficult as it - IM JUST KIDDING I ACTUALLY NEED HELP THO​

Answers

45 degrees. A triangle should add up to 180 degrees. So 76+59+?=180. The ? Is 45 so that is your answer. Another way is to take 180 and subtract 59 and 76 which will leave you with 45.
Following the Triangle Sum Theorem, the three angles in a triangle must sum up to 180°.

Therefore, we can create an equation to find the measure of angle 1, given the two other angles.

76+59+x=180. x=the measure of angle 1 (unknown).

135+x=180. [76+59=135]

135-135+x=180-135 [Isolate x by subtracting 135 from both sides]

x=45.

Therefore, the angle measure of angle 1 = 45°
Other Questions
Is this statement true or false?Impressionist paintings by John Twachtman depict a moment in time.truefalse What happend when matter condenses??Plzz Answer??? Is this table proportional?XY1 3 34 125 157 21 Your engineering department is asked to evaluate the performance of a new 370-hp sports car. You know that 27% of the engine's power can be converted to mechanical energy of the 1200-kg car, and that the power delivered is independent of the car's velocity. What do you report for the time it will take to accelerate from rest to 60 mi/h on a level road? A geriatric team wants to involve the patients family in his or her care. When is the best time to invite the family to become part of the team?not at allbefore the patients procedureafter the patients dischargeat the very beginning 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Which one is correct Which of the following lines of a dialogue is most appropriate for a naturalist play A. Where are we going? What's happening? B. Does thou require a repast this morn?C. Hark, what light younder window breaks?D. Whither are we bond? At optimum light intensity, which atmospheric gas most directly influences the rate of photosynthesis? * Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)? Which details should you look for in determining the setting of a story? Check all that apply. the storys time period where the author lives the characters environment how long the story is where the story takes place As a missionary, where did you spend most of your time?A) at a churchB) in the fieldsC) in CaliforniaD) at a mission Por que tenen que dar el motivo de viaje?Los agentes quieren visitar los pasajeros en su hotelLos agentes can la informacin a los pasajerosLos pasajeros necesitan poner el motivo en el pasaporteLos pasajeros no pueden pasar por la aduana sin la informacin When Hugo puts a book and a candle on a scale, the scale reads 8.705 lbs. When he removes the book, the scale reads 4.93 lbs. How much does the book weigh? A colony of bacteria is growing at a rate of 50% per hour.If this rate of growth remains the same and the colony starts with 100 bacteria, approximately how many bacteria will there be after 6 hours?1139 bacteria Dwayne is selling hamburgers and cheeseburgers. He has 100 burger buns. Each hamburger sells for $3, and each cheeseburger sells for $3. 50. Which system of inequalities represents the number of hamburgers, h, and the number of cheeseburgers, c, he must sell to have sales of at least $80? h c 80 3h 3. 5c 100 h c 80 3h 3. 5c 100 h c 100 3h 3. 5c 80 h c 100 3h 3. 5c 80. Match the following regulations to their appropriate categories. Name and describe one way the Crusades affected the Christian population. 50 points + brainilest!! Is Neptunes volume more than 100 times as large as earth the narrowest official definition of the money supply is